![]() |
descseq |
Please help by correcting and extending the Wiki pages.
descseq reads a sequence and writes it to file but with a different name and / or description. All other records including the sequence itself are left unaltered.
Set the name of a sequence to "myclone23"
% descseq -seq dna.text -out clone23.seq -name "myclone23" Alter the name or description of a sequence. |
Go to the input files for this example
Go to the output files for this example
Example 2
Set the description of a sequence to "This is my clone number 244"
% descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" Alter the name or description of a sequence. |
Go to the output files for this example
Example 3
Append some text to the description of a sequence
% descseq -seq dna.text -out est4.seq -desc " (submitted)" -append Alter the name or description of a sequence. |
Go to the output files for this example
Alter the name or description of a sequence. Version: EMBOSS:6.4.0.0 Standard (Mandatory) qualifiers: [-sequence] sequence (Gapped) sequence filename and optional format, or reference (input USA) [-outseq] seqout [ |
Qualifier | Type | Description | Allowed values | Default |
---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||
[-sequence] (Parameter 1) |
sequence | (Gapped) sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
[-outseq] (Parameter 2) |
seqout | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format |
Additional (Optional) qualifiers | ||||
-name | string | Name of the sequence | Any string | |
-description | string | Description of the sequence | Any string | |
Advanced (Unprompted) qualifiers | ||||
-append | boolean | This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. | Boolean value Yes/No | No |
Associated qualifiers | ||||
"-sequence" associated sequence qualifiers | ||||
-sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 |
-send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 |
-sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
-sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
-snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
-sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N |
-slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N |
-supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N |
-sformat1 -sformat_sequence |
string | Input sequence format | Any string | |
-sdbname1 -sdbname_sequence |
string | Database name | Any string | |
-sid1 -sid_sequence |
string | Entryname | Any string | |
-ufo1 -ufo_sequence |
string | UFO features | Any string | |
-fformat1 -fformat_sequence |
string | Features format | Any string | |
-fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |
"-outseq" associated seqout qualifiers | ||||
-osformat2 -osformat_outseq |
string | Output seq format | Any string | |
-osextension2 -osextension_outseq |
string | File name extension | Any string | |
-osname2 -osname_outseq |
string | Base file name | Any string | |
-osdirectory2 -osdirectory_outseq |
string | Output directory | Any string | |
-osdbname2 -osdbname_outseq |
string | Database name to add | Any string | |
-ossingle2 -ossingle_outseq |
boolean | Separate file for each entry | Boolean value Yes/No | N |
-oufo2 -oufo_outseq |
string | UFO features | Any string | |
-offormat2 -offormat_outseq |
string | Features format | Any string | |
-ofname2 -ofname_outseq |
string | Features file name | Any string | |
-ofdirectory2 -ofdirectory_outseq |
string | Output directory | Any string | |
General qualifiers | ||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N |
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
-warning | boolean | Report warnings | Boolean value Yes/No | Y |
-error | boolean | Report errors | Boolean value Yes/No | Y |
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
-die | boolean | Report dying program messages | Boolean value Yes/No | Y |
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
The output is a standard EMBOSS sequence file.
The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
>myclone23 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>EMBOSS_001 This is my clone number 244 ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
>EMBOSS_001 (submitted) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file. descseq let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing.
The default action is to replace the existing name or description with your new one, but by using the qualifier -append what you enter is appended to the existing name or description. Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one.
Program name | Description |
---|---|
aligncopy | Reads and writes alignments |
aligncopypair | Reads and writes pairs from alignments |
biosed | Replace or delete sequence sections |
codcopy | Copy and reformat a codon usage table |
cutseq | Removes a section from a sequence |
degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
entret | Retrieves sequence entries from flatfile databases and files |
extractalign | Extract regions from a sequence alignment |
extractfeat | Extract features from sequence(s) |
extractseq | Extract regions from a sequence |
featcopy | Reads and writes a feature table |
featreport | Reads and writes a feature table |
feattext | Return a feature table original text |
listor | Write a list file of the logical OR of two sets of sequences |
makenucseq | Create random nucleotide sequences |
makeprotseq | Create random protein sequences |
maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
maskambigprot | Masks all ambiguity characters in protein sequences with X |
maskfeat | Write a sequence with masked features |
maskseq | Write a sequence with masked regions |
newseq | Create a sequence file from a typed-in sequence |
nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
noreturn | Remove carriage return from ASCII files |
nospace | Remove whitespace from an ASCII text file |
notab | Replace tabs with spaces in an ASCII text file |
notseq | Write to file a subset of an input stream of sequences |
nthseq | Write to file a single sequence from an input stream of sequences |
nthseqset | Reads and writes (returns) one set of sequences from many |
pasteseq | Insert one sequence into another |
revseq | Reverse and complement a nucleotide sequence |
seqcount | Reads and counts sequences |
seqret | Reads and writes (returns) sequences |
seqretsetall | Reads and writes (returns) many sets of sequences |
seqretsplit | Reads sequences and writes them to individual files |
sizeseq | Sort sequences by size |
skipredundant | Remove redundant sequences from an input set |
skipseq | Reads and writes (returns) sequences, skipping first few |
splitsource | Split sequence(s) into original source sequences |
splitter | Split sequence(s) into smaller sequences |
trimest | Remove poly-A tails from nucleotide sequences |
trimseq | Remove unwanted characters from start and end of sequence(s) |
trimspace | Remove extra whitespace from an ASCII text file |
union | Concatenate multiple sequences into a single sequence |
vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
yank | Add a sequence reference (a full USA) to a list file |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.