vrnasubopt

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Calculate RNA suboptimals

Description

This is a port of the Vienna RNA package program RNAsubopt.

It reads RNA sequences and calculates all suboptimal secondary structures within a user-defined energy range above the minimum free energy (mfe). It prints the suboptimal structures in bracket notation followed by the energy in kcal/mol to stdout.

Optionally, it will produce Boltzmann weighted samples of secondary structures.

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnasubopt


% vrnasubopt 
Calculate RNA suboptimals
Input nucleotide sequence: rna1.seq
Vienna RNAfold output file [rna1.vrnasubopt]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Calculate RNA suboptimals
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnasubopt] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -subtype            menu       [0] Method (Values: 0 (Within 'erange' of
                                  the optimum); 1 (Using stochastic
                                  backtracing with 'nrandom'); 2 (Using Zucker
                                  suboptimals))
   -temperature        float      [37.0] Temperature (Any numeric value)
   -circular           boolean    [N] Allow circular RNA
   -dos                boolean    [N] DOS special corrections
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -erange             float      [1.0] Calculate suboptimal structures within
                                  erange of the mfe (Any numeric value)
   -prange             float      [0.0] Only print structures with energy
                                  within prange of the mfe (Any numeric value)
   -sort               boolean    [N] Sort structures by energy
   -logml              boolean    [N] Logarithmic energy function for
                                  multi-loops
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -nrandom            integer    [0] Number of random suboptimal structures
                                  (Any integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
sequence Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
[-outfile]
(Parameter 2)
outfile Vienna RNAfold output file Output file <*>.vrnasubopt
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile infile Vienna RNA structure constraints file (optional) Input file Required
-paramfile infile Vienna RNA parameters file (optional) Input file Required
-subtype list Method
0 (Within 'erange' of the optimum)
1 (Using stochastic backtracing with 'nrandom')
2 (Using Zucker suboptimals)
0
-temperature float Temperature Any numeric value 37.0
-circular boolean Allow circular RNA Boolean value Yes/No No
-dos boolean DOS special corrections Boolean value Yes/No No
-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes
-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes
-[no]convert boolean Convert T to U Boolean value Yes/No Yes
-nsbases string Non-standard bases Any string  
-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-erange float Calculate suboptimal structures within erange of the mfe Any numeric value 1.0
-prange float Only print structures with energy within prange of the mfe Any numeric value 0.0
-sort boolean Sort structures by energy Boolean value Yes/No No
-logml boolean Logarithmic energy function for multi-loops Boolean value Yes/No No
-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2
-nrandom integer Number of random suboptimal structures Any integer value 0
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1
-sbegin_sequence
integer Start of the sequence to be used Any integer value 0
-send1
-send_sequence
integer End of the sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnasubopt reads any normal sequence USAs.

Input files for usage example

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

vrnasubopt Outputs a graph to the specified graphics device. Outputs a report format file.

Output files for usage example

File: rna1.vrnasubopt

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA   -300    100
......((....)).(((((........))))).......  -2.20
...............(((((........))))).......  -3.00
((((.....(((((.....)))))...)))).........  -2.70

Data files

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

Be careful, the number of structures returned grows exponentially with both sequence length and energy range. None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
banana Plot bending and curvature data for B-DNA
btwisted Calculate the twisting in a B-DNA sequence
einverted Finds inverted repeats in nucleotide sequences
ovrnaalifold RNA alignment folding
ovrnaalifoldpf RNA alignment folding with partition
ovrnacofold RNA cofolding
ovrnacofoldconc RNA cofolding with concentrations
ovrnacofoldpf RNA cofolding with partitioning
ovrnadistance RNA distances
ovrnaduplex RNA duplex calculation
ovrnaeval RNA eval
ovrnaevalpair RNA eval with cofold
ovrnafold Calculate secondary structures of RNAs
ovrnafoldpf Secondary structures of RNAs with partition
ovrnaheat RNA melting
ovrnainverse RNA sequences matching a structure
ovrnalfold Calculate locally stable secondary structures of RNAs
ovrnaplot Plot vrnafold output
ovrnasubopt Calculate RNA suboptimals
sirna Finds siRNA duplexes in mRNA
vrna2dfold Structures and samples of k,l neighbourhoods
vrnaaliduplex RNA duplex calculation for two sequence alignments
vrnaalifold RNA alignment folding
vrnaalifoldpf RNA alignment folding with partition
vrnacofold RNA cofolding
vrnacofoldconc RNA cofolding with concentrations
vrnacofoldpf RNA cofolding with partitioning
vrnadistance RNA distances
vrnaduplex RNA duplex calculation
vrnaeval RNA eval
vrnaevalpair RNA eval with cofold
vrnafold Calculate secondary structures of RNAs
vrnafoldpf Secondary structures of RNAs with partition
vrnaheat RNA melting
vrnainverse RNA sequences matching a structure
vrnalalifoldpf Locally stable 2ry structures for a set of aligned RNAs
vrnalfold Calculate locally stable secondary structures of RNAs
vrnalfoldz Locally stable secondary structures of RNAs plus zscore
vrnapkplex RNA structures plus pseudoknots
vrnaplfold Locally stable RNA 2ry structures - pair probabilities
vrnaplot Plot vrnafold output

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments