EMBASSY: VIENNA2: vrnaplfold

vrnaplfold

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Locally stable RNA 2ry structures - pair probabilities

Description

Computes local pair probabilities for base pairs with a maximal span of L. The probabilities are averaged over all windows of size L that contain the base pair.

Output consists of a dot plot in a postscript file, where the averaged pair probabilities can easily be parsed and visually inspected.

It is possible to compute the probability that a stretch of x consequtive nucleotides is unpaired, which is useful for predicting possible binding sites. Again this probability is averaged over all windows containing the region.

The output is a plain text matrix containing on each line a position i followed by the probability that i is unpaired, [i-1..i] is unpaired [i-2..i] is unpaired and so on to the probability that [i-x+1..i] is unpaired.

Algorithm

For a sequence of length n and a window size of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to "scan" very large genomes for short stable RNA structures.

Usage

Here is a sample session with vrnaplfold

% vrnaplfold Locally stable RNA 2ry structures - pair probabilities Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnaplfold]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

Locally stable RNA 2ry structures - pair probabilities
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnaplfold] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -paramfile          infile     Vienna RNA parameters file (optional)
   -winsize            integer    [70] Window size for averaging pair
                                  probabilities (Integer 2 or more)
   -separation         integer    [$(winsize)] Maximum allowed separation of a
                                  base pair to span (Any integer value)
   -cutoff             float      [0.01] Report only bp with avg prob > cutoff
                                  (Any numeric value)
   -onthefly           boolean    [N] Output during computation (automatic for
                                  very long seqs)
   -ulength            integer    [31] Calc mean probability that regions of
                                  ulength are unpaired (Integer 2 or more)
   -openenergy         boolean    [N] Output logarithms, not probabilities
                                  (activates ulength)
   -[no]convert        boolean    [Y] Convert T to U
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -nsbases            string     Non-standard bases (Any string)
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -plexoutfile        outfile    [*.vrnaplfold] Vienna RNAplfold plex output
                                  file
   -ssoutfile          outfile    [*.vrnaplfold] Vienna RNA structure
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-plexoutfile" associated qualifiers
   -odirectory         string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default

Standard (Mandatory) qualifiers

[-sequence]
(Parameter 1) sequence Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required

[-outfile]
(Parameter 2) outfile Vienna RNAfold output file Output file <*>.vrnaplfold

Additional (Optional) qualifiers

(none)

Advanced (Unprompted) qualifiers

-paramfile infile Vienna RNA parameters file (optional) Input file Required

-winsize integer Window size for averaging pair probabilities Integer 2 or more 70

-separation integer Maximum allowed separation of a base pair to span Any integer value $(winsize)

-cutoff float Report only bp with avg prob > cutoff Any numeric value 0.01

-onthefly boolean Output during computation (automatic for very long seqs) Boolean value Yes/No No

-ulength integer Calc mean probability that regions of ulength are unpaired Integer 2 or more 31

-openenergy boolean Output logarithms, not probabilities (activates ulength) Boolean value Yes/No No

-[no]convert boolean Convert T to U Boolean value Yes/No Yes

-temperature float Temperature Any numeric value 37.0

-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes

-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2

-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes

-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes

-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes

-nsbases string Non-standard bases Any string

-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0

-plexoutfile outfile Vienna RNAplfold plex output file Output file <*>.vrnaplfold

-ssoutfile outfile Vienna RNA structure postscript output file Output file <*>.vrnaplfold

Associated qualifiers

"-sequence" associated sequence qualifiers

-sbegin1
-sbegin_sequence integer Start of the sequence to be used Any integer value 0

-send1
-send_sequence integer End of the sequence to be used Any integer value 0

-sreverse1
-sreverse_sequence boolean Reverse (if DNA) Boolean value Yes/No N

-sask1
-sask_sequence boolean Ask for begin/end/reverse Boolean value Yes/No N

-snucleotide1
-snucleotide_sequence boolean Sequence is nucleotide Boolean value Yes/No N

-sprotein1
-sprotein_sequence boolean Sequence is protein Boolean value Yes/No N

-slower1
-slower_sequence boolean Make lower case Boolean value Yes/No N

-supper1
-supper_sequence boolean Make upper case Boolean value Yes/No N

-sformat1
-sformat_sequence string Input sequence format Any string

-sdbname1
-sdbname_sequence string Database name Any string

-sid1
-sid_sequence string Entryname Any string

-ufo1
-ufo_sequence string UFO features Any string

-fformat1
-fformat_sequence string Features format Any string

-fopenfile1
-fopenfile_sequence string Features file name Any string

"-outfile" associated outfile qualifiers

-odirectory2
-odirectory_outfile string Output directory Any string

"-plexoutfile" associated outfile qualifiers

-odirectory string Output directory Any string

"-ssoutfile" associated outfile qualifiers

-odirectory string Output directory Any string

General qualifiers

-auto boolean Turn off prompts Boolean value Yes/No N

-stdout boolean Write first file to standard output Boolean value Yes/No N

-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N

-options boolean Prompt for standard and additional values Boolean value Yes/No N

-debug boolean Write debug output to program.dbg Boolean value Yes/No N

-verbose boolean Report some/full command line options Boolean value Yes/No Y

-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N

-warning boolean Report warnings Boolean value Yes/No Y

-error boolean Report errors Boolean value Yes/No Y

-fatal boolean Report fatal errors Boolean value Yes/No Y

-die boolean Report dying program messages Boolean value Yes/No Y

-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnaplfold reads any normal sequence USAs.

Input files for usage example

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

vrnaplfold outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: rna1.vrnaplfold

#unpaired probabilities
 #i$	l=1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	20	21	22	23	24	25	26	27	28	29	30	31	
1	0.7197006	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
2	0.7436407	0.6970294	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
3	0.6191163	0.6187358	0.6098213	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
4	0.498733	0.4495528	0.4492764	0.446118	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
5	0.7394522	0.448445	0.4234183	0.423145	0.4207406	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
6	0.6993007	0.6964077	0.4070592	0.383444	0.3832446	0.3809704	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
7	0.6459923	0.6230276	0.6203004	0.3416656	0.319917	0.319799	0.3175991	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
8	0.8914124	0.6331154	0.6131883	0.6104808	0.3325677	0.3109899	0.3108782	0.3086932	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
9	0.9779347	0.88718	0.6303147	0.6106271	0.6079246	0.3310934	0.3095998	0.3094893	0.3073068	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
10	0.6651365	0.66319	0.5726773	0.4026313	0.3905143	0.3899147	0.2912215	0.2843506	0.2843264	0.2822798	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
11	0.5181724	0.5024481	0.5009607	0.4144767	0.3013552	0.2914242	0.2912392	0.268241	0.2640238	0.2640165	0.2620029	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
12	0.3966587	0.3925504	0.3806482	0.3797934	0.2953032	0.2598187	0.2545819	0.254514	0.2499149	0.2490548	0.2490517	0.2482227	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
13	0.4166699	0.2701829	0.2672206	0.2664674	0.2661387	0.2657253	0.2402795	0.2374645	0.2374085	0.2339115	0.2335324	0.2335299	0.2335004	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
14	0.5077176	0.3548537	0.255988	0.2530381	0.2522964	0.2519891	0.2515976	0.2268277	0.2240578	0.2240024	0.2205592	0.2201829	0.2201804	0.2201509	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
15	0.9289085	0.5013714	0.3500168	0.2522725	0.2493285	0.2485947	0.2482889	0.2478983	0.2231985	0.2204339	0.220379	0.2169402	0.2165641	0.2165617	0.2165323	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
16	0.5491737	0.499974	0.1383552	0.06173901	0.01770257	0.01743567	0.01718166	0.01704812	0.01676035	0.0159869	0.01499615	0.01495264	0.01322167	0.01299422	0.01299253	0.01297731	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
17	0.492003	0.4915342	0.4789087	0.127728	0.05341019	0.01077281	0.01054951	0.0103734	0.01032887	0.01029984	0.009931776	0.009882992	0.009840096	0.008156462	0.007999311	0.007997643	0.007993475	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
18	0.5300212	0.4908897	0.4904473	0.4778701	0.1273119	0.05311017	0.01052843	0.01032884	0.01015424	0.01010982	0.01008109	0.009714787	0.009666248	0.009625529	0.007942027	0.007784922	0.007783403	0.007779241	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
19	0.5345269	0.5252989	0.4900584	0.4896358	0.4777258	0.1272482	0.0530616	0.01048893	0.0102895	0.0101175	0.01007345	0.01004503	0.009686363	0.009638501	0.00959781	0.007915753	0.007758765	0.007757246	0.007753087	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
20	0.2938011	0.2178109	0.2093876	0.1741712	0.1737537	0.1618618	0.09264044	0.05281496	0.01031686	0.01021499	0.01004555	0.01000151	0.009973111	0.009617601	0.009570041	0.009529871	0.007848078	0.007691143	0.00768975	0.007685594	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
21	0.5410661	0.1509547	0.1357306	0.1324175	0.09847581	0.09806244	0.08617698	0.01716552	0.01158671	0.009571132	0.009469874	0.00930615	0.009262353	0.009234453	0.00888206	0.008834842	0.00879475	0.007113214	0.006956324	0.006954971	0.006950825	NA	NA	NA	NA	NA	NA	NA	NA	NA	NA	
22	0.5486111	0.5381838	0.1494382	0.1345549	0.1313296	0.0976468	0.09723398	0.08535472	0.01659107	0.01137542	0.009478606	0.009428651	0.009282437	0.009238653	0.009210774	0.008859028	0.008811947	0.008772864	0.007091382	0.006934543	0.006933304	0.006929161	NA	NA	NA	NA	NA	NA	NA	NA	NA	
23	0.5779542	0.4885846	0.4796176	0.09148143	0.07691182	0.0737204	0.041823	0.04141072	0.02953678	0.01647448	0.01128255	0.009417575	0.009397679	0.009258923	0.009215148	0.009187285	0.008835907	0.008788888	0.008751319	0.007069868	0.006913072	0.006911946	0.006907803	NA	NA	NA	NA	NA	NA	NA	NA	
24	0.6807958	0.564877	0.4782268	0.4700847	0.08214608	0.07005819	0.06688309	0.03556655	0.03515476	0.02328336	0.01419873	0.01118786	0.009335508	0.009321892	0.009187429	0.009143662	0.009115814	0.00876792	0.008721302	0.008686477	0.007005319	0.006848573	0.006847543	0.006843404	NA	NA	NA	NA	NA	NA	NA	
25	0.9286778	0.6749446	0.5594603	0.4729211	0.4649512	0.07702016	0.06498695	0.06183046	0.03427249	0.03386097	0.02198973	0.01292678	0.01041049	0.009263179	0.009249608	0.009115283	0.00907155	0.009043804	0.008696801	0.008650266	0.008615445	0.006934362	0.006777625	0.006776596	0.00677246	NA	NA	NA	NA	NA	NA	
26	0.9226826	0.9135081	0.6621726	0.5495316	0.4634732	0.4555982	0.06768	0.05759898	0.05445764	0.027163	0.02675213	0.0148811	0.01265188	0.01026225	0.009130244	0.009119857	0.00898836	0.008944632	0.008916894	0.00857424	0.008528087	0.00852787	0.006847151	0.006690446	0.006689497	0.006685365	NA	NA	NA	NA	NA	
27	0.9568866	0.8924959	0.8840739	0.6342872	0.521754	0.4357178	0.4278505	0.03993313	0.02986068	0.02672265	0.02627353	0.0258627	0.01399168	0.01176822	0.01020726	0.009110556	0.009100181	0.008968688	0.008924962	0.008897228	0.008554839	0.008508709	0.008508493	0.006827796	0.006671094	0.006670145	0.006666013	NA	NA	NA	NA	
28	0.5707227	0.5279095	0.5033991	0.4960224	0.4559324	0.4367568	0.4307586	0.4242831	0.03675038	0.02668882	0.02440408	0.02398079	0.02357612	0.0117051	0.009768442	0.008258639	0.007174381	0.007164079	0.007032592	0.006988866	0.006961132	0.006862964	0.006816834	0.006816618	0.00680398	0.006647277	0.006646329	0.006642197	NA	NA	NA	
29	0.1000946	0.09936374	0.08651488	0.06806355	0.06403412	0.04164643	0.02935304	0.02491859	0.0238316	0.02373901	0.01413692	0.01187859	0.01146118	0.0114405	0.01142795	0.00953604	0.008035511	0.00695852	0.006948358	0.006816927	0.006779901	0.006755525	0.006659811	0.006643336	0.006643121	0.0066309	0.006620482	0.006619533	0.006618146	NA	NA	
30	0.04212957	0.02734344	0.02724145	0.02510973	0.02150803	0.01902369	0.01131287	0.007777365	0.006482667	0.005960174	0.005927005	0.005133633	0.003494208	0.00333512	0.003320714	0.003308208	0.002805891	0.002387648	0.001997445	0.001996324	0.00199592	0.001958894	0.00193452	0.001839876	0.001823508	0.001823441	0.001811239	0.001800831	0.001800826	0.00179944	NA	
31	0.08970175	0.02378813	0.01796818	0.01793937	0.01638724	0.01394927	0.01212305	0.007262412	0.004782568	0.003863023	0.003622643	0.0035961	0.00299023	0.00272714	0.002589841	0.002583057	0.002575963	0.002190187	0.001866336	0.001535559	0.001534685	0.001534373	0.00152295	0.001500659	0.001406252	0.001393227	0.00139316	0.001380999	0.001379235	0.001379229	0.001378097	
32	0.4046785	0.04197307	0.02227	0.01706292	0.01703848	0.01551884	0.0131867	0.01138409	0.006738941	0.004375689	0.00350003	0.003268632	0.003242948	0.002667915	0.002413869	0.002340781	0.002334089	0.002326994	0.001960578	0.001662951	0.001465021	0.001464188	0.001463892	0.001452469	0.001430178	0.001335786	0.001322762	0.001322697	0.001310536	0.001308771	0.001308766	
33	0.4660732	0.3245468	0.03665849	0.01863054	0.01367627	0.01365318	0.01345239	0.01124228	0.01087654	0.006531392	0.004238782	0.003378075	0.003223865	0.003199462	0.002625391	0.002371841	0.002298849	0.002294138	0.00228949	0.00192369	0.001626166	0.001428299	0.001427467	0.00142717	0.001426869	0.001426658	0.001332375	0.001320984	0.001320919	0.001308773	0.001307655	
34	0.9810539	0.4651036	0.3235795	0.03596802	0.01832148	0.01358025	0.01355982	0.01335927	0.01115417	0.01078872	0.006446877	0.004155445	0.003295065	0.003140877	0.003116621	0.002542614	0.002371484	0.002298501	0.00229379	0.002289142	0.00192339	0.001625902	0.001428056	0.001427224	0.001426927	0.001426626	0.001426414	0.001332204	0.001320813	0.001320748	0.001308625	
35	0.9477427	0.929693	0.4635668	0.3229289	0.03585941	0.01821423	0.01356034	0.01354018	0.01333974	0.01113466	0.01076927	0.006427448	0.004136024	0.003275646	0.003121504	0.003097248	0.002523241	0.002352112	0.002283549	0.002278838	0.00227419	0.001908439	0.001612397	0.001428056	0.001427224	0.001426927	0.001426626	0.001426414	0.001332204	0.001320813	0.001320748	
36	0.8765555	0.8529093	0.8443623	0.4130547	0.3142067	0.02942281	0.01663505	0.01250788	0.01248844	0.01237839	0.01045369	0.01011437	0.006139605	0.003972821	0.003156927	0.003005592	0.002981652	0.002407648	0.00223976	0.002172326	0.002167771	0.002163124	0.001798928	0.00150624	0.001322051	0.00132122	0.001320923	0.001320622	0.00132041	0.001320106	0.001308715	
37	0.7453287	0.74477	0.7225333	0.7190154	0.3212035	0.311898	0.02909327	0.01644054	0.01234831	0.01232987	0.01225946	0.01035532	0.01002735	0.00608749	0.003931429	0.003118355	0.002969118	0.002953285	0.00238114	0.002213445	0.002146069	0.00214438	0.00214438	0.001785406	0.001492861	0.001308708	0.001307878	0.001307582	0.001307582	0.001307582	0.001307288	
38	0.7726298	0.7400598	0.7397377	0.7181263	0.714758	0.3210706	0.31184	0.02908583	0.01643369	0.01234406	0.01232842	0.01225806	0.01035409	0.01002614	0.006086484	0.003930525	0.003117488	0.002968256	0.002952424	0.002380879	0.002213184	0.002145835	0.002144146	0.002144146	0.001785204	0.00149268	0.001308559	0.001307795	0.001307512	0.001307512	0.001307512	
39	0.8346883	0.7724098	0.7400116	0.7396905	0.7180912	0.714728	0.3210555	0.3118273	0.02907325	0.01643174	0.01234217	0.01232653	0.01225617	0.01035249	0.01002454	0.006085186	0.003930138	0.003117322	0.00296809	0.002952324	0.002380779	0.002213167	0.002145818	0.002144129	0.002144129	0.001785188	0.001492665	0.001308543	0.00130778	0.001307497	0.001307497	
40	0.9997527	0.8344672	0.7723556	0.7399744	0.7396542	0.7180676	0.7147051	0.3210475	0.3118213	0.02906734	0.01643131	0.01234176	0.01232612	0.01225576	0.01035225	0.01002431	0.00608504	0.003930037	0.003117254	0.002968023	0.002952282	0.002380737	0.002213156	0.002145807	0.002144118	0.002144118	0.001785177	0.001492654	0.001308533	0.00130777	0.001307486

File: rna1.plex

#energy necessary to unpair as well as to unpair if i-1 is unpaired also, if i+1 is unpaired also in dekacal/mol
1	20	-0	3	
2	18	1	0	
3	29	11	6	
4	42	19	30	
5	18	6	0	
6	22	3	2	
7	26	7	21	
8	7	1	5	
9	1	0	0	
10	25	23	1	
11	40	17	0	
12	56	17	26	
13	53	23	22	
14	41	9	37	
15	4	0	5	
16	36	38	0	
17	43	6	4	
18	39	0	1	
19	38	0	18	
20	75	55	78	
21	37	41	1	
22	36	0	10	
23	33	7	11	
24	23	1	19	
25	4	0	0	
26	4	1	4	
27	2	2	4	
28	34	36	0	
29	141	107	26	
30	195	79	81	
31	148	35	139	
32	55	46	22	
33	47	13	45	
34	1	0	1	
35	3	3	1	
36	8	6	0	
37	18	10	2	
38	15	0	4	
39	11	0	11	
40	0	0	-0

Graphics File: rna1.ssps

[vrnaplfold results]

Data files

None.

Notes

None.

References

Bernhart et al (2006). Bioinformatics 22: 614-615 Bompfuenewerer et al (2007). J. Math. Biol. 6: 129-144

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

Program name	Description
banana	Plot bending and curvature data for B-DNA
btwisted	Calculate the twisting in a B-DNA sequence
einverted	Finds inverted repeats in nucleotide sequences
ovrnaalifold	RNA alignment folding
ovrnaalifoldpf	RNA alignment folding with partition
ovrnacofold	RNA cofolding
ovrnacofoldconc	RNA cofolding with concentrations
ovrnacofoldpf	RNA cofolding with partitioning
ovrnadistance	RNA distances
ovrnaduplex	RNA duplex calculation
ovrnaeval	RNA eval
ovrnaevalpair	RNA eval with cofold
ovrnafold	Calculate secondary structures of RNAs
ovrnafoldpf	Secondary structures of RNAs with partition
ovrnaheat	RNA melting
ovrnainverse	RNA sequences matching a structure
ovrnalfold	Calculate locally stable secondary structures of RNAs
ovrnaplot	Plot vrnafold output
ovrnasubopt	Calculate RNA suboptimals
sirna	Finds siRNA duplexes in mRNA
vrna2dfold	Structures and samples of k,l neighbourhoods
vrnaaliduplex	RNA duplex calculation for two sequence alignments
vrnaalifold	RNA alignment folding
vrnaalifoldpf	RNA alignment folding with partition
vrnacofold	RNA cofolding
vrnacofoldconc	RNA cofolding with concentrations
vrnacofoldpf	RNA cofolding with partitioning
vrnadistance	RNA distances
vrnaduplex	RNA duplex calculation
vrnaeval	RNA eval
vrnaevalpair	RNA eval with cofold
vrnafold	Calculate secondary structures of RNAs
vrnafoldpf	Secondary structures of RNAs with partition
vrnaheat	RNA melting
vrnainverse	RNA sequences matching a structure
vrnalalifoldpf	Locally stable 2ry structures for a set of aligned RNAs
vrnalfold	Calculate locally stable secondary structures of RNAs
vrnalfoldz	Locally stable secondary structures of RNAs plus zscore
vrnapkplex	RNA structures plus pseudoknots
vrnaplot	Plot vrnafold output
vrnasubopt	Calculate RNA suboptimals

Author(s)

Alan Bleasby
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None

Wiki

Function

Description

Algorithm

Usage

Command line arguments

Input file format

Input files for usage example

File: rna1.seq

Output file format

Output files for usage example

File: rna1.vrnaplfold

File: rna1.plex

Graphics File: rna1.ssps

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments