EMBASSY: VIENNA2: vrnalalifoldpf

vrnalalifoldpf

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Locally stable 2ry structures for a set of aligned RNAs

Description

Under development. Output currently unreliable.

Calculates locally stable secondary structures for a set of aligned RNAs. The program reads aligned RNA sequences and calculates locally stable RNA secondary structure with a maximal base pair span.

Algorithm

For a sequence of length n and a base pair span of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to "scan" very large genomes for short RNA structures.

Uses the Turner 2004 Nearest Neighbor model.

Usage

Here is a sample session with vrnalalifoldpf

% vrnalalifoldpf Locally stable 2ry structures for a set of aligned RNAs Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnalalifoldpf]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

Locally stable 2ry structures for a set of aligned RNAs
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqset     (Aligned) nucleotide sequence set filename
                                  and optional format, or reference (input
                                  USA)
  [-outfile]           outfile    [*.vrnalalifoldpf] Vienna RNAfold output
                                  file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -paramfile          infile     Vienna RNA parameters file (optional)
   -rsumfile           infile     Vienna RNA Ribosum file (optional)
   -separation         integer    [70] Maximum allowed separation of a base
                                  pair to span (Any integer value)
   -csv                boolean    [N] Output comma-separated values
   -cutoff             float      [0.0005] Report only bps with an avg prob >
                                  cutoff in dotplot (Any numeric value)
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -most               boolean    [N] Use most informative sequence algorithm
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -dangles            menu       [2] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -nsbases            string     Non-standard bases (Any string)
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -covariance         float      [1.0] Weight for covariance (Any numeric
                                  value)
   -nfactor            float      [1.0] Penalty for non-compatible seqs in
                                  covariance (Any numeric value)
   -alignoutfile       outfile    [*.vrnalalifoldpf] Vienna RNA alignment
                                  output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-alignoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default

Standard (Mandatory) qualifiers

[-sequence]
(Parameter 1) seqset (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) Readable set of sequences Required

[-outfile]
(Parameter 2) outfile Vienna RNAfold output file Output file <*>.vrnalalifoldpf

Additional (Optional) qualifiers

(none)

Advanced (Unprompted) qualifiers

-paramfile infile Vienna RNA parameters file (optional) Input file Required

-rsumfile infile Vienna RNA Ribosum file (optional) Input file Required

-separation integer Maximum allowed separation of a base pair to span Any integer value 70

-csv boolean Output comma-separated values Boolean value Yes/No No

-cutoff float Report only bps with an avg prob > cutoff in dotplot Any numeric value 0.0005

-scale float Estimate of ensemble free energy Any numeric value 1.07

-most boolean Use most informative sequence algorithm Boolean value Yes/No No

-temperature float Temperature Any numeric value 37.0

-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes

-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
2

-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes

-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes

-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes

-nsbases string Non-standard bases Any string

-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0

-covariance float Weight for covariance Any numeric value 1.0

-nfactor float Penalty for non-compatible seqs in covariance Any numeric value 1.0

-alignoutfile outfile Vienna RNA alignment output file Output file <*>.vrnalalifoldpf

Associated qualifiers

"-sequence" associated seqset qualifiers

-sbegin1
-sbegin_sequence integer Start of each sequence to be used Any integer value 0

-send1
-send_sequence integer End of each sequence to be used Any integer value 0

-sreverse1
-sreverse_sequence boolean Reverse (if DNA) Boolean value Yes/No N

-sask1
-sask_sequence boolean Ask for begin/end/reverse Boolean value Yes/No N

-snucleotide1
-snucleotide_sequence boolean Sequence is nucleotide Boolean value Yes/No N

-sprotein1
-sprotein_sequence boolean Sequence is protein Boolean value Yes/No N

-slower1
-slower_sequence boolean Make lower case Boolean value Yes/No N

-supper1
-supper_sequence boolean Make upper case Boolean value Yes/No N

-sformat1
-sformat_sequence string Input sequence format Any string

-sdbname1
-sdbname_sequence string Database name Any string

-sid1
-sid_sequence string Entryname Any string

-ufo1
-ufo_sequence string UFO features Any string

-fformat1
-fformat_sequence string Features format Any string

-fopenfile1
-fopenfile_sequence string Features file name Any string

"-outfile" associated outfile qualifiers

-odirectory2
-odirectory_outfile string Output directory Any string

"-alignoutfile" associated outfile qualifiers

-odirectory string Output directory Any string

General qualifiers

-auto boolean Turn off prompts Boolean value Yes/No N

-stdout boolean Write first file to standard output Boolean value Yes/No N

-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N

-options boolean Prompt for standard and additional values Boolean value Yes/No N

-debug boolean Write debug output to program.dbg Boolean value Yes/No N

-verbose boolean Report some/full command line options Boolean value Yes/No Y

-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N

-warning boolean Report warnings Boolean value Yes/No Y

-error boolean Report errors Boolean value Yes/No Y

-fatal boolean Report fatal errors Boolean value Yes/No Y

-die boolean Report dying program messages Boolean value Yes/No Y

-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnalalifoldpf reads any normal sequence USAs.

Input files for usage example

File: ecoli6s.fasta

>X01238.1/1-183
AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA
AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AL627277.1/108623-108805
AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG
AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA
AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGGCGGCA.UC.UCGGAG.AUUC
>AJ414145.1/90993-91174
AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG
AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA
AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG
CGACGGCA.CC.UCGGAG.AUCC
>U32767.1/6538-6734
.AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA
AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA
AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG
CAGCGGCACUC.UGGGGU.CUUC
>AE006208.1/8365-8185
.AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG
AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA
AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG
CAGCGGCA.UC.UCGGGUUCUUC
>Y00334.1/77-254
CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G
GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA
AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA
CAGCGGCA.CGACCGGGG.AGCU
>AE004317.1/5626-5807
UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A
GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA
AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU
CAACGGCA.UC.CCGGGG.UUC.

Output file format

vrnalalifoldpf outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: ecoli6s.vrnalalifoldpf

AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC

File: ecoli6s.alirna

7 sequence; length of alignment 203
alifold output

Data files

None.

Notes

None.

References

Turner & Mathews (2009). Nucleic Acids Research. 38, D280-D282.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

Under development at Vienna RNA HQ. Output currently unreliable.

Program name	Description
banana	Plot bending and curvature data for B-DNA
btwisted	Calculate the twisting in a B-DNA sequence
einverted	Finds inverted repeats in nucleotide sequences
ovrnaalifold	RNA alignment folding
ovrnaalifoldpf	RNA alignment folding with partition
ovrnacofold	RNA cofolding
ovrnacofoldconc	RNA cofolding with concentrations
ovrnacofoldpf	RNA cofolding with partitioning
ovrnadistance	RNA distances
ovrnaduplex	RNA duplex calculation
ovrnaeval	RNA eval
ovrnaevalpair	RNA eval with cofold
ovrnafold	Calculate secondary structures of RNAs
ovrnafoldpf	Secondary structures of RNAs with partition
ovrnaheat	RNA melting
ovrnainverse	RNA sequences matching a structure
ovrnalfold	Calculate locally stable secondary structures of RNAs
ovrnaplot	Plot vrnafold output
ovrnasubopt	Calculate RNA suboptimals
sirna	Finds siRNA duplexes in mRNA
vrna2dfold	Structures and samples of k,l neighbourhoods
vrnaaliduplex	RNA duplex calculation for two sequence alignments
vrnaalifold	RNA alignment folding
vrnaalifoldpf	RNA alignment folding with partition
vrnacofold	RNA cofolding
vrnacofoldconc	RNA cofolding with concentrations
vrnacofoldpf	RNA cofolding with partitioning
vrnadistance	RNA distances
vrnaduplex	RNA duplex calculation
vrnaeval	RNA eval
vrnaevalpair	RNA eval with cofold
vrnafold	Calculate secondary structures of RNAs
vrnafoldpf	Secondary structures of RNAs with partition
vrnaheat	RNA melting
vrnainverse	RNA sequences matching a structure
vrnalfold	Calculate locally stable secondary structures of RNAs
vrnalfoldz	Locally stable secondary structures of RNAs plus zscore
vrnapkplex	RNA structures plus pseudoknots
vrnaplfold	Locally stable RNA 2ry structures - pair probabilities
vrnaplot	Plot vrnafold output
vrnasubopt	Calculate RNA suboptimals

Author(s)

Alan Bleasby
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None

Wiki

Function

Description

Algorithm

Usage

Command line arguments

Input file format

Input files for usage example

File: ecoli6s.fasta

Output file format

Output files for usage example

File: ecoli6s.vrnalalifoldpf

File: ecoli6s.alirna

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments