EMBASSY: VIENNA2: vrnapkplex

vrnapkplex

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

RNA structures plus pseudoknots

Description

PKplex reads RNA sequences, calculates their minimum free energy (mfe) structure including pseudoknots and prints the mfe structure in bracket notation.

It also produces a PostScript file with a plot of the pseudoknot‐free secondary structure graph, in which the bases forming the pseuodknot are marked red.

Algorithm

The calculation of mfe structures is based on a dynamic programming algorithm originally developed by M. Zuker and P. Stiegler. The partition function algorithm is based on work by J.S. McCaskill. The energy parameters are taken from Mathews et al.

Usage

Here is a sample session with vrnapkplex

% vrnapkplex RNA structures plus pseudoknots Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.vrnapkplex]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

RNA structures plus pseudoknots
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.vrnapkplex] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -cutoff             float      [0.01] Report only bp with avg prob > cutoff
                                  (Any numeric value)
   -energycutoff       integer    [-810] Pseudoknot initiation cost (Any
                                  integer value)
   -suboptimals        integer    [0] Energy difference from optimal for
                                  subopt to be printed (Any integer value)
   -extended           boolean    [N] Extended output
   -ssoutfile          outfile    [*.vrnapkplex] Vienna RNA structure
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default

Standard (Mandatory) qualifiers

[-sequence]
(Parameter 1) sequence Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required

[-outfile]
(Parameter 2) outfile Vienna RNAfold output file Output file <*>.vrnapkplex

Additional (Optional) qualifiers

(none)

Advanced (Unprompted) qualifiers

-paramfile infile Vienna RNA parameters file (optional) Input file Required

-temperature float Temperature Any numeric value 37.0

-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes

-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes

-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes

-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes

-[no]convert boolean Convert T to U Boolean value Yes/No Yes

-nsbases string Non-standard bases Any string

-cutoff float Report only bp with avg prob > cutoff Any numeric value 0.01

-energycutoff integer Pseudoknot initiation cost Any integer value -810

-suboptimals integer Energy difference from optimal for subopt to be printed Any integer value 0

-extended boolean Extended output Boolean value Yes/No No

-ssoutfile outfile Vienna RNA structure postscript output file Output file <*>.vrnapkplex

Associated qualifiers

"-sequence" associated sequence qualifiers

-sbegin1
-sbegin_sequence integer Start of the sequence to be used Any integer value 0

-send1
-send_sequence integer End of the sequence to be used Any integer value 0

-sreverse1
-sreverse_sequence boolean Reverse (if DNA) Boolean value Yes/No N

-sask1
-sask_sequence boolean Ask for begin/end/reverse Boolean value Yes/No N

-snucleotide1
-snucleotide_sequence boolean Sequence is nucleotide Boolean value Yes/No N

-sprotein1
-sprotein_sequence boolean Sequence is protein Boolean value Yes/No N

-slower1
-slower_sequence boolean Make lower case Boolean value Yes/No N

-supper1
-supper_sequence boolean Make upper case Boolean value Yes/No N

-sformat1
-sformat_sequence string Input sequence format Any string

-sdbname1
-sdbname_sequence string Database name Any string

-sid1
-sid_sequence string Entryname Any string

-ufo1
-ufo_sequence string UFO features Any string

-fformat1
-fformat_sequence string Features format Any string

-fopenfile1
-fopenfile_sequence string Features file name Any string

"-outfile" associated outfile qualifiers

-odirectory2
-odirectory_outfile string Output directory Any string

"-ssoutfile" associated outfile qualifiers

-odirectory string Output directory Any string

General qualifiers

-auto boolean Turn off prompts Boolean value Yes/No N

-stdout boolean Write first file to standard output Boolean value Yes/No N

-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N

-options boolean Prompt for standard and additional values Boolean value Yes/No N

-debug boolean Write debug output to program.dbg Boolean value Yes/No N

-verbose boolean Report some/full command line options Boolean value Yes/No Y

-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N

-warning boolean Report warnings Boolean value Yes/No Y

-error boolean Report errors Boolean value Yes/No Y

-fatal boolean Report fatal errors Boolean value Yes/No Y

-die boolean Report dying program messages Boolean value Yes/No Y

-version boolean Report version number and exit Boolean value Yes/No N

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-sequence] (Parameter 1)	sequence	Nucleotide sequence filename and optional format, or reference (input USA)	Readable sequence	Required
[-outfile] (Parameter 2)	outfile	Vienna RNAfold output file	Output file	<>*.vrnapkplex
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-paramfile	infile	Vienna RNA parameters file (optional)	Input file	Required
-temperature	float	Temperature	Any numeric value	37.0
-[no]tetraloop	boolean	Stabilizing energies for tetra-loops	Boolean value Yes/No	Yes
-[no]lp	boolean	Allow lonely pairs	Boolean value Yes/No	Yes
-[no]gu	boolean	Allow GU pairs	Boolean value Yes/No	Yes
-[no]closegu	boolean	Allow GU pairs at end of helices	Boolean value Yes/No	Yes
-[no]convert	boolean	Convert T to U	Boolean value Yes/No	Yes
-nsbases	string	Non-standard bases	Any string
-cutoff	float	Report only bp with avg prob > cutoff	Any numeric value	0.01
-energycutoff	integer	Pseudoknot initiation cost	Any integer value	-810
-suboptimals	integer	Energy difference from optimal for subopt to be printed	Any integer value	0
-extended	boolean	Extended output	Boolean value Yes/No	No
-ssoutfile	outfile	Vienna RNA structure postscript output file	Output file	<>*.vrnapkplex
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1 -sbegin_sequence	integer	Start of the sequence to be used	Any integer value	0
-send1 -send_sequence	integer	End of the sequence to be used	Any integer value	0
-sreverse1 -sreverse_sequence	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_sequence	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_sequence	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_sequence	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_sequence	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_sequence	boolean	Make upper case	Boolean value Yes/No	N
-sformat1 -sformat_sequence	string	Input sequence format	Any string
-sdbname1 -sdbname_sequence	string	Database name	Any string
-sid1 -sid_sequence	string	Entryname	Any string
-ufo1 -ufo_sequence	string	UFO features	Any string
-fformat1 -fformat_sequence	string	Features format	Any string
-fopenfile1 -fopenfile_sequence	string	Features file name	Any string
"-outfile" associated outfile qualifiers
-odirectory2 -odirectory_outfile	string	Output directory	Any string
"-ssoutfile" associated outfile qualifiers
-odirectory	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

vrnapkplex reads any normal sequence USAs.

Input files for usage example

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

vrnapkplex outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: rna1.vrnapkplex

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
...............(((((........))))).......   (5.10)

Graphics File: rna1.ssps

[vrnapkplex results]

Data files

None.

Notes

None.

References

Zuker & Stiegler (1981). Nucleic Acids Res. 1981 Jan 10;9(1):133-48 McCaskill (1990). Biopolymers, 29, 1105-19. Mathews et al (1999). JMB, 288, pp 911‐940, 1999

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

Program name	Description
banana	Plot bending and curvature data for B-DNA
btwisted	Calculate the twisting in a B-DNA sequence
einverted	Finds inverted repeats in nucleotide sequences
ovrnaalifold	RNA alignment folding
ovrnaalifoldpf	RNA alignment folding with partition
ovrnacofold	RNA cofolding
ovrnacofoldconc	RNA cofolding with concentrations
ovrnacofoldpf	RNA cofolding with partitioning
ovrnadistance	RNA distances
ovrnaduplex	RNA duplex calculation
ovrnaeval	RNA eval
ovrnaevalpair	RNA eval with cofold
ovrnafold	Calculate secondary structures of RNAs
ovrnafoldpf	Secondary structures of RNAs with partition
ovrnaheat	RNA melting
ovrnainverse	RNA sequences matching a structure
ovrnalfold	Calculate locally stable secondary structures of RNAs
ovrnaplot	Plot vrnafold output
ovrnasubopt	Calculate RNA suboptimals
sirna	Finds siRNA duplexes in mRNA
vrna2dfold	Structures and samples of k,l neighbourhoods
vrnaaliduplex	RNA duplex calculation for two sequence alignments
vrnaalifold	RNA alignment folding
vrnaalifoldpf	RNA alignment folding with partition
vrnacofold	RNA cofolding
vrnacofoldconc	RNA cofolding with concentrations
vrnacofoldpf	RNA cofolding with partitioning
vrnadistance	RNA distances
vrnaduplex	RNA duplex calculation
vrnaeval	RNA eval
vrnaevalpair	RNA eval with cofold
vrnafold	Calculate secondary structures of RNAs
vrnafoldpf	Secondary structures of RNAs with partition
vrnaheat	RNA melting
vrnainverse	RNA sequences matching a structure
vrnalalifoldpf	Locally stable 2ry structures for a set of aligned RNAs
vrnalfold	Calculate locally stable secondary structures of RNAs
vrnalfoldz	Locally stable secondary structures of RNAs plus zscore
vrnaplfold	Locally stable RNA 2ry structures - pair probabilities
vrnaplot	Plot vrnafold output
vrnasubopt	Calculate RNA suboptimals

Author(s)

Alan Bleasby
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None

Wiki

Function

Description

Algorithm

Usage

Command line arguments

Input file format

Input files for usage example

File: rna1.seq

Output file format

Output files for usage example

File: rna1.vrnapkplex

Graphics File: rna1.ssps

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

History

Target users

Comments