|
|
vrna2dfold |
Please help by correcting and extending the Wiki pages.
Uses the Turner 2004 nearest neighbor model.
% vrna2dfold Structures and samples of k,l neighbourhoods Input nucleotide sequence: rnaaln1.seq File of two dot-notation representative structures: rna2d.fold Vienna RNAfold output file [rna1.vrna2dfold]: |
Go to the input files for this example
Go to the output files for this example
Structures and samples of k,l neighbourhoods
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-sequence] sequence Nucleotide sequence filename and optional
format, or reference (input USA)
[-constraintfile] infile File of two dot-notation representative
structures
[-outfile] outfile [*.vrna2dfold] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-paramfile infile Vienna RNA parameters file (optional)
-partfunc boolean [N] Calculate partition function and
Bolzmann probabilities
-nback integer [0] Number of stochastic backtraces to
display (Integer 0 or more)
-neighbourhood string This can be specified multiple times
(
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-sequence] (Parameter 1) |
sequence | Nucleotide sequence filename and optional format, or reference (input USA) | Readable sequence | Required | ||||||||
| [-constraintfile] (Parameter 2) |
infile | File of two dot-notation representative structures | Input file | Required | ||||||||
| [-outfile] (Parameter 3) |
outfile | Vienna RNAfold output file | Output file | <*>.vrna2dfold | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -partfunc | boolean | Calculate partition function and Bolzmann probabilities | Boolean value Yes/No | No | ||||||||
| -nback | integer | Number of stochastic backtraces to display | Integer 0 or more | 0 | ||||||||
| -neighbourhood | string | This can be specified multiple times (<k>:<l>,<m>:<n>,... | Any string | |||||||||
| -scale | float | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
| -circular | boolean | Circular RNA | Boolean value Yes/No | No | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -onedist | integer | Maximum distance to first reference structure | Any integer value | -1 | ||||||||
| -twodist | integer | Maximum distance to second reference structure | Any integer value | -1 | ||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -dangles | list | Method |
|
2 | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
| -nthreads | integer | Number of threads (if OpenMP enabled in compilation) | Integer 1 or more | 1 | ||||||||
| Associated qualifiers | ||||||||||||
| "-sequence" associated sequence qualifiers | ||||||||||||
| -sbegin1 -sbegin_sequence |
integer | Start of the sequence to be used | Any integer value | 0 | ||||||||
| -send1 -send_sequence |
integer | End of the sequence to be used | Any integer value | 0 | ||||||||
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||
| -sid1 -sid_sequence |
string | Entryname | Any string | |||||||||
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||
| -fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||
| -odirectory3 -odirectory_outfile |
string | Output directory | Any string | |||||||||
| General qualifiers | ||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||
>rna1 CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA >rna2 ---UACUCCAAGGACCGUAUCUUUCUCAGUGCGACAG--- |
...............(((((........)))))....... ................((((........))))........ |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA ...............(((((........)))))....... ( -3.00) ...............(((((........)))))....... ( -3.00) <ref 1> ................((((........))))........ ( -0.70) <ref 2> k l MFE MFE-structure 0 1 -3.00 ...............(((((........)))))....... 1 0 -0.70 ................((((........))))........ 1 2 -1.30 ............(..(((((........))))).)..... 2 1 0.30 ..............(.((((........)))))....... 2 3 -2.20 ......((....)).(((((........)))))....... 3 2 0.10 ......((....))..((((........))))........ 3 4 -1.80 ...............((((.((.....))))))....... 4 3 0.50 ................(((.((.....)))))........ 4 5 -1.60 ...((((........(((((........)))))..)))). 5 4 0.00 ........................................ 5 6 -1.40 ...((((....(...(((((........))))).))))). 6 5 0.90 ...((((....(....((((........))))..))))). 6 7 -0.20 (.((......)))..((((.((.....))))))....... 7 6 0.70 ..............................((....)).. 7 8 -0.40 ...((((........((((.((.....))))))..)))). 8 7 -0.80 .............................(((....))). 8 9 -0.20 ...((((....(...((((.((.....)))))).))))). 9 8 -0.10 ..........((((........)))).............. 9 10 1.40 ...((((....(...(((..((.....)).))).))))). 10 9 -0.60 .........(((((.....)))))................ 10 11 4.00 ...((((....(...((...((.....))..)).))))). 11 10 -0.70 ((((......((........)).....))))......... 11 12 6.20 ...((((....(...(....((.....))...).))))). 12 11 -1.80 ((((.....(((........)))....))))......... 12 13 9.40 ...((((....(...(...(((.....)).).).))))). 13 12 -1.70 ((((.....((((......))))....))))......... 13 14 14.00 .(((.((...))(..(...(((.....)).).).)))).. 14 13 -2.70 ((((.....(((((.....)))))...))))......... 14 15 24.10 .(((.((...))(..((...)(((...)).).).)))).. 15 14 -1.50 ..(((((..(((((.....)))))...)))).)....... 16 15 -0.10 .((((((..(((((.....)))))...))).....))).. 17 16 3.00 .(((..((((((((..(...).))))...)).)).))).. 18 17 10.90 .(((..((((((((...).)))((...)))).)).))).. |
| Program name | Description |
|---|---|
| banana | Plot bending and curvature data for B-DNA |
| btwisted | Calculate the twisting in a B-DNA sequence |
| einverted | Finds inverted repeats in nucleotide sequences |
| ovrnaalifold | RNA alignment folding |
| ovrnaalifoldpf | RNA alignment folding with partition |
| ovrnacofold | RNA cofolding |
| ovrnacofoldconc | RNA cofolding with concentrations |
| ovrnacofoldpf | RNA cofolding with partitioning |
| ovrnadistance | RNA distances |
| ovrnaduplex | RNA duplex calculation |
| ovrnaeval | RNA eval |
| ovrnaevalpair | RNA eval with cofold |
| ovrnafold | Calculate secondary structures of RNAs |
| ovrnafoldpf | Secondary structures of RNAs with partition |
| ovrnaheat | RNA melting |
| ovrnainverse | RNA sequences matching a structure |
| ovrnalfold | Calculate locally stable secondary structures of RNAs |
| ovrnaplot | Plot vrnafold output |
| ovrnasubopt | Calculate RNA suboptimals |
| sirna | Finds siRNA duplexes in mRNA |
| vrnaaliduplex | RNA duplex calculation for two sequence alignments |
| vrnaalifold | RNA alignment folding |
| vrnaalifoldpf | RNA alignment folding with partition |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalalifoldpf | Locally stable 2ry structures for a set of aligned RNAs |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnalfoldz | Locally stable secondary structures of RNAs plus zscore |
| vrnapkplex | RNA structures plus pseudoknots |
| vrnaplfold | Locally stable RNA 2ry structures - pair probabilities |
| vrnaplot | Plot vrnafold output |
| vrnasubopt | Calculate RNA suboptimals |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.