descseq

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Alter the name or description of a sequence

Description

descseq reads a sequence and writes it to file but with a different name and / or description. All other records including the sequence itself are left unaltered.

Usage

Here is a sample session with descseq

Set the name of a sequence to "myclone23" 


% descseq -seq dna.text -out clone23.seq -name "myclone23" 
Alter the name or description of a sequence.

Go to the input files for this example
Go to the output files for this example

Example 2

Set the description of a sequence to "This is my clone number 244" 


% descseq -seq dna.text -out xy24.seq -desc "This is my clone number 244" 
Alter the name or description of a sequence.

Go to the output files for this example

Example 3

Append some text to the description of a sequence 


% descseq -seq dna.text -out est4.seq -desc " (submitted)" -append 
Alter the name or description of a sequence.

Go to the output files for this example

Command line arguments 

Alter the name or description of a sequence.
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -name               string     Name of the sequence (Any string)
   -description        string     Description of the sequence (Any string)

   Advanced (Unprompted) qualifiers:
   -append             boolean    [N] This allows you to append the name or
                                  description you have given on to the end of
                                  the existing name or description of the
                                  sequence.

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)		 sequence (Gapped) sequence filename and optional format, or reference (input USA) Readable sequence Required
[-outseq]
(Parameter 2)		 seqout Sequence filename and optional format (output USA) Writeable sequence <*>.format
Additional (Optional) qualifiers
-name string Name of the sequence Any string  
-description string Description of the sequence Any string  
Advanced (Unprompted) qualifiers
-append boolean This allows you to append the name or description you have given on to the end of the existing name or description of the sequence. Boolean value Yes/No No
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1
-sbegin_sequence		 integer Start of the sequence to be used Any integer value 0
-send1
-send_sequence		 integer End of the sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence		 boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence		 boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence		 boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence		 boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence		 boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence		 boolean Make upper case Boolean value Yes/No N
-sformat1
-sformat_sequence		 string Input sequence format Any string  
-sdbname1
-sdbname_sequence		 string Database name Any string  
-sid1
-sid_sequence		 string Entryname Any string  
-ufo1
-ufo_sequence		 string UFO features Any string  
-fformat1
-fformat_sequence		 string Features format Any string  
-fopenfile1
-fopenfile_sequence		 string Features file name Any string  
"-outseq" associated seqout qualifiers
-osformat2
-osformat_outseq		 string Output seq format Any string  
-osextension2
-osextension_outseq		 string File name extension Any string  
-osname2
-osname_outseq		 string Base file name Any string  
-osdirectory2
-osdirectory_outseq		 string Output directory Any string  
-osdbname2
-osdbname_outseq		 string Database name to add Any string  
-ossingle2
-ossingle_outseq		 boolean Separate file for each entry Boolean value Yes/No N
-oufo2
-oufo_outseq		 string UFO features Any string  
-offormat2
-offormat_outseq		 string Features format Any string  
-ofname2
-ofname_outseq		 string Features file name Any string  
-ofdirectory2
-ofdirectory_outseq		 string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

descseq reads a single nucleotide or protein sequence.

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

File: dna.text

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output file format

descseq writes the sequence file with a changed name or description.

The output is a standard EMBOSS sequence file.

The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Output files for usage example

File: clone23.seq

>myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output files for usage example 2

File: xy24.seq

>EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output files for usage example 3

File: est4.seq

>EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

None.

Notes

Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file. descseq let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing.

The default action is to replace the existing name or description with your new one, but by using the qualifier -append what you enter is appended to the existing name or description. Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None noted.

See also

Program name Description
aligncopy Reads and writes alignments
aligncopypair Reads and writes pairs from alignments
biosed Replace or delete sequence sections
codcopy Copy and reformat a codon usage table
cutseq Removes a section from a sequence
degapseq Removes non-alphabetic (e.g. gap) characters from sequences
entret Retrieves sequence entries from flatfile databases and files
extractalign Extract regions from a sequence alignment
extractfeat Extract features from sequence(s)
extractseq Extract regions from a sequence
featcopy Reads and writes a feature table
featreport Reads and writes a feature table
feattext Return a feature table original text
listor Write a list file of the logical OR of two sets of sequences
makenucseq Create random nucleotide sequences
makeprotseq Create random protein sequences
maskambignuc Masks all ambiguity characters in nucleotide sequences with N
maskambigprot Masks all ambiguity characters in protein sequences with X
maskfeat Write a sequence with masked features
maskseq Write a sequence with masked regions
newseq Create a sequence file from a typed-in sequence
nohtml Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn Remove carriage return from ASCII files
nospace Remove whitespace from an ASCII text file
notab Replace tabs with spaces in an ASCII text file
notseq Write to file a subset of an input stream of sequences
nthseq Write to file a single sequence from an input stream of sequences
nthseqset Reads and writes (returns) one set of sequences from many
pasteseq Insert one sequence into another
revseq Reverse and complement a nucleotide sequence
seqcount Reads and counts sequences
seqret Reads and writes (returns) sequences
seqretsetall Reads and writes (returns) many sets of sequences
seqretsplit Reads sequences and writes them to individual files
sizeseq Sort sequences by size
skipredundant Remove redundant sequences from an input set
skipseq Reads and writes (returns) sequences, skipping first few
splitsource Split sequence(s) into original source sequences
splitter Split sequence(s) into smaller sequences
trimest Remove poly-A tails from nucleotide sequences
trimseq Remove unwanted characters from start and end of sequence(s)
trimspace Remove extra whitespace from an ASCII text file
union Concatenate multiple sequences into a single sequence
vectorstrip Removes vectors from the ends of nucleotide sequence(s)
yank Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None