ovrnaplot |
Please help by correcting and extending the Wiki pages.
This is a port of the Vienna RNA package program RNAplot.
It reads the output of ovrnafold (RNA sequences and structures) and produces drawings of the secondary structure graph.
See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/
% ovrnaplot Plot vrnafold output Vienna RNAfold output file: ../ovrnafold-keep/rna1.ovrnafold Vienna RNAfold output file [rna1.ovrnaplot]: |
Go to the input files for this example
Go to the output files for this example
Plot vrnafold output Version: EMBOSS:6.4.0.0 Standard (Mandatory) qualifiers: [-structuresfile] infile Vienna RNAfold output file [-outfile] outfile [*.ovrnaplot] Vienna RNAfold output file Additional (Optional) qualifiers: (none) Advanced (Unprompted) qualifiers: -layout menu [naview] Layout (Values: radial (Simple radial); naview (naview)) -optype menu [ps] Type (Values: ps (postscript); gml (graph meta language); svg (scaleable vector graphics); xrna (XRNA save file)) -pre string Pre-annotation (Any string) -post string Post-annotation (Any string) Associated qualifiers: "-outfile" associated qualifiers -odirectory2 string Output directory General qualifiers: -auto boolean Turn off prompts -stdout boolean Write first file to standard output -filter boolean Read first file from standard input, write first file to standard output -options boolean Prompt for standard and additional values -debug boolean Write debug output to program.dbg -verbose boolean Report some/full command line options -help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose -warning boolean Report warnings -error boolean Report errors -fatal boolean Report fatal errors -die boolean Report dying program messages -version boolean Report version number and exit |
Qualifier | Type | Description | Allowed values | Default | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Standard (Mandatory) qualifiers | ||||||||||||
[-structuresfile] (Parameter 1) |
infile | Vienna RNAfold output file | Input file | Required | ||||||||
[-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.ovrnaplot | ||||||||
Additional (Optional) qualifiers | ||||||||||||
(none) | ||||||||||||
Advanced (Unprompted) qualifiers | ||||||||||||
-layout | list | Layout |
|
naview | ||||||||
-optype | list | Type |
|
ps | ||||||||
-pre | string | Pre-annotation | Any string | |||||||||
-post | string | Post-annotation | Any string | |||||||||
Associated qualifiers | ||||||||||||
"-outfile" associated outfile qualifiers | ||||||||||||
-odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
General qualifiers | ||||||||||||
-auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
-stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
-filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
-options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
-debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
-verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
-help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
-warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
-error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
-fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
-die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
-version | boolean | Report version number and exit | Boolean value Yes/No | N |
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA .(((..((....)).(((((........)))))..))).. ( -3.50) |
Program name | Description |
---|---|
banana | Plot bending and curvature data for B-DNA |
btwisted | Calculate the twisting in a B-DNA sequence |
einverted | Finds inverted repeats in nucleotide sequences |
ovrnaalifold | RNA alignment folding |
ovrnaalifoldpf | RNA alignment folding with partition |
ovrnacofold | RNA cofolding |
ovrnacofoldconc | RNA cofolding with concentrations |
ovrnacofoldpf | RNA cofolding with partitioning |
ovrnadistance | RNA distances |
ovrnaduplex | RNA duplex calculation |
ovrnaeval | RNA eval |
ovrnaevalpair | RNA eval with cofold |
ovrnafold | Calculate secondary structures of RNAs |
ovrnafoldpf | Secondary structures of RNAs with partition |
ovrnaheat | RNA melting |
ovrnainverse | RNA sequences matching a structure |
ovrnalfold | Calculate locally stable secondary structures of RNAs |
ovrnasubopt | Calculate RNA suboptimals |
sirna | Finds siRNA duplexes in mRNA |
vrna2dfold | Structures and samples of k,l neighbourhoods |
vrnaaliduplex | RNA duplex calculation for two sequence alignments |
vrnaalifold | RNA alignment folding |
vrnaalifoldpf | RNA alignment folding with partition |
vrnacofold | RNA cofolding |
vrnacofoldconc | RNA cofolding with concentrations |
vrnacofoldpf | RNA cofolding with partitioning |
vrnadistance | RNA distances |
vrnaduplex | RNA duplex calculation |
vrnaeval | RNA eval |
vrnaevalpair | RNA eval with cofold |
vrnafold | Calculate secondary structures of RNAs |
vrnafoldpf | Secondary structures of RNAs with partition |
vrnaheat | RNA melting |
vrnainverse | RNA sequences matching a structure |
vrnalalifoldpf | Locally stable 2ry structures for a set of aligned RNAs |
vrnalfold | Calculate locally stable secondary structures of RNAs |
vrnalfoldz | Locally stable secondary structures of RNAs plus zscore |
vrnapkplex | RNA structures plus pseudoknots |
vrnaplfold | Locally stable RNA 2ry structures - pair probabilities |
vrnaplot | Plot vrnafold output |
vrnasubopt | Calculate RNA suboptimals |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.