ovrnafold

Wiki

Please help by correcting and extending the Wiki pages.

Function

Description

It reads RNA sequences, calculates their minimum free energy (mfe) structure and output the mfe structure in bracket notation and its free energy. It produces plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix.

The original program has additional inputs and produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into ovrnafold for a single sequence and ovrnafoldpf for a pair of sequences

Algorithm

Usage

% ovrnafold -constraintfile rna1.fold Calculate secondary structures of RNAs Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.ovrnafold]:

Go to the input files for this example
Go to the output files for this example

Example 2

% ovrnafold Calculate secondary structures of RNAs Input nucleotide sequence: rna1.seq Vienna RNAfold output file [rna1.ovrnafold]:

Go to the output files for this example

Command line arguments

Calculate secondary structures of RNAs
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
  [-outfile]           outfile    [*.ovrnafold] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -constraintfile     infile     Vienna RNA structure constraints file
                                  (optional)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -circular           boolean    [N] Allow circular RNA
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -scale              float      [1.07] Estimate of ensemble free energy (Any
                                  numeric value)
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -ssoutfile          outfile    [*.ovrnafold] Vienna RNA structure
                                  postscript output file

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   "-ssoutfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-sequence] (Parameter 1)	sequence	Nucleotide sequence filename and optional format, or reference (input USA)	Readable sequence	Required
[-outfile] (Parameter 2)	outfile	Vienna RNAfold output file	Output file	<*>.ovrnafold
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-constraintfile	infile	Vienna RNA structure constraints file (optional)	Input file	Required
-paramfile	infile	Vienna RNA parameters file (optional)	Input file	Required
-temperature	float	Temperature	Any numeric value	37.0
-circular	boolean	Allow circular RNA	Boolean value Yes/No	No
-[no]gu	boolean	Allow GU pairs	Boolean value Yes/No	Yes
-[no]closegu	boolean	Allow GU pairs at end of helices	Boolean value Yes/No	Yes
-[no]lp	boolean	Allow lonely pairs	Boolean value Yes/No	Yes
-[no]convert	boolean	Convert T to U	Boolean value Yes/No	Yes
-nsbases	string	Non-standard bases	Any string
-[no]tetraloop	boolean	Stabilizing energies for tetra-loops	Boolean value Yes/No	Yes
-energy	list	Rarely used option to fold sequences from the ABCD... alphabet	0 (BP) 1 (Any with GC) 2 (Any with AU parameters)	0
-scale	float	Estimate of ensemble free energy	Any numeric value	1.07
-dangles	list	Method	0 (Ignore) 1 (Only unpaired bases for just one dangling end) 2 (Always use dangling energies) 3 (Allow coaxial stacking of adjacent helices)	1
-ssoutfile	outfile	Vienna RNA structure postscript output file	Output file	<*>.ovrnafold
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1 -sbegin_sequence	integer	Start of the sequence to be used	Any integer value	0
-send1 -send_sequence	integer	End of the sequence to be used	Any integer value	0
-sreverse1 -sreverse_sequence	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_sequence	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_sequence	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_sequence	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_sequence	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_sequence	boolean	Make upper case	Boolean value Yes/No	N
-sformat1 -sformat_sequence	string	Input sequence format	Any string
-sdbname1 -sdbname_sequence	string	Database name	Any string
-sid1 -sid_sequence	string	Entryname	Any string
-ufo1 -ufo_sequence	string	UFO features	Any string
-fformat1 -fformat_sequence	string	Features format	Any string
-fopenfile1 -fopenfile_sequence	string	Features file name	Any string
"-outfile" associated outfile qualifiers
-odirectory2 -odirectory_outfile	string	Output directory	Any string
"-ssoutfile" associated outfile qualifiers
-odirectory	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

Input files for usage example

File: rna1.fold

.((.......<<..........||............))..

File: rna1.seq

>rna1
CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA

Output file format

Output files for usage example

Graphics File: rna1.ssps

File: rna1.ovrnafold

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
...((((..(((((.....)))))...))))......... ( -2.20)

Output files for usage example 2

Graphics File: rna1.ssps

File: rna1.ovrnafold

CACUACUCCAAGGACCGUAUCUUUCUCAGUGCGACAGUAA
.(((..((....)).(((((........)))))..))).. ( -3.50)

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

Comments