stssearch

Wiki

Please help by correcting and extending the Wiki pages.

Function

Description

stssearch searches one or more DNA sequences with a set of STS primers and reports expected matches. The database to search, the input primer pairs file and an output file for matches are specified. For each pair of primers, it looks for matches between the primers and the query sequence in either orientation. Details of any matches are written to the output file. Only one primer need match for it to be reported.

Usage

% stssearch Search a DNA database for matches with a set of STS primers Input nucleotide sequence(s): @eclac.list Primer pairs file: lac.primers Output file [j01636.stssearch]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

Search a DNA database for matches with a set of STS primers
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-seqall]            seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
  [-infile]            infile     Primer pairs file
  [-outfile]           outfile    [*.stssearch] Output file name

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-seqall" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-seqall] (Parameter 1)	seqall	Nucleotide sequence(s) filename and optional format, or reference (input USA)	Readable sequence(s)	Required
[-infile] (Parameter 2)	infile	Primer pairs file	Input file	Required
[-outfile] (Parameter 3)	outfile	Output file name	Output file	<*>.stssearch
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-seqall" associated seqall qualifiers
-sbegin1 -sbegin_seqall	integer	Start of each sequence to be used	Any integer value	0
-send1 -send_seqall	integer	End of each sequence to be used	Any integer value	0
-sreverse1 -sreverse_seqall	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_seqall	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_seqall	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_seqall	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_seqall	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_seqall	boolean	Make upper case	Boolean value Yes/No	N
-sformat1 -sformat_seqall	string	Input sequence format	Any string
-sdbname1 -sdbname_seqall	string	Database name	Any string
-sid1 -sid_seqall	string	Entryname	Any string
-ufo1 -ufo_seqall	string	UFO features	Any string
-fformat1 -fformat_seqall	string	Features format	Any string
-fopenfile1 -fopenfile_seqall	string	Features file name	Any string
"-outfile" associated outfile qualifiers
-odirectory3 -odirectory_outfile	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

Input files for usage example

File: eclac.list

#Formerly ECLAC
tembl:J01636

#Formerly ECLACA
tembl:X51872

#Formerly ECLACI
tembl:V00294

#Formerly ECLACY
tembl:V00295

#Formerly ECLACZ
tembl:V00296

File: lac.primers

PrimA ACCAGACACCCATCAACAG    TATTTATGCCAGCCAGCCAG
PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG
PrimC CGTCAGTATCCCCGTTTACAG  TATCGCCAAAATCACCGCC
PrimD AATACGCAAACCGCCTCTCC   TTATCCGCTCACAATTCCACAC
PrimE AATACGCAAACCGCCTCTCC   CACAACCCGCTCACAATTCCA

The primers file consists of three columns separated by tabs or spaces.

The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.

Output file format

Output files for usage example

File: j01636.stssearch

J01636: PrimA PrimerA matched at 532
J01636: (rev) PrimA PrimerB matched at 689
J01636: PrimB PrimerA matched at 5743
J01636: (rev) PrimB PrimerB matched at 5942
J01636: PrimC PrimerA matched at 2954
J01636: (rev) PrimC PrimerB matched at 3069
J01636: PrimD PrimerA matched at 1074
J01636: (rev) PrimD PrimerB matched at 1261
J01636: PrimE PrimerA matched at 1074
X51872: PrimB PrimerA matched at 98
X51872: (rev) PrimB PrimerB matched at 297
V00294: PrimA PrimerA matched at 484
V00294: (rev) PrimA PrimerB matched at 641
V00294: PrimD PrimerA matched at 1026
V00294: PrimE PrimerA matched at 1026
V00295: PrimB PrimerA matched at 1439
V00296: PrimC PrimerA matched at 1668
V00296: (rev) PrimC PrimerB matched at 1783

The output file consists of one line per match. This consists of:

• The name of the sequence that the match is found in, followed by a ':'.
• If the match is in the reverse sense, it has a '(rev)'.
• The name of the primer pair.
• 'PrimerA' or 'PrimerB'.
• 'matched at' the start of the match position.

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

If you want something that only reports matches of both primer pairs and can find mismatches, use primersearch.

Author(s)

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

Comments