|
|
primersearch |
Please help by correcting and extending the Wiki pages.
primersearch reads in primer pairs from an input file and searches them against DNA sequence(s) specified by the user. Each of the primers in a pair is searched against the sequence and potential amplimers are reported. The output file is in the format of Whitehead primer3_core program. The user can specify a maximum percent mismatch level; for example, 10% mismatch on a primer of length 20bp means that the program will classify a primer as matching a sequence if 18 of the 20 base pairs matches. It will only report matches if both primers in the pair have a match in opposite orientations.
Each primer pair is specified in the input file by a name, followed by two primer sequences, primerA and primerB. The program first compares primerA to the forward strand and if it matches, primerB is compared to the reverse strand. The approach is then reversed, with the primerB being compared to the forward strand and primerA to the reverse. In this way all possible amplimers are reported.
% primersearch tembl:z52466 Search DNA sequences for matches with primer pairs Primer pairs file: primers Allowed percent mismatch [0]: Whitehead primer3_core program output file [z52466.primersearch]: |
Go to the input files for this example
Go to the output files for this example
Example 2
Here we run the same example but allowing 20% mismatch between the primers and the sequence:
% primersearch tembl:z52466 Search DNA sequences for matches with primer pairs Primer pairs file: primers Allowed percent mismatch [0]: 20 Whitehead primer3_core program output file [z52466.primersearch]: |
Go to the output files for this example
Search DNA sequences for matches with primer pairs
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-seqall] seqall Nucleotide sequence(s) filename and optional
format, or reference (input USA)
[-infile] infile Primer pairs file
[-mismatchpercent] integer [0] Allowed percent mismatch (Any integer
value)
[-outfile] outfile [*.primersearch] Whitehead primer3_core
program output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers: (none)
Associated qualifiers:
"-seqall" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory4 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-seqall] (Parameter 1) |
seqall | Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required |
| [-infile] (Parameter 2) |
infile | Primer pairs file | Input file | Required |
| [-mismatchpercent] (Parameter 3) |
integer | Allowed percent mismatch | Any integer value | 0 |
| [-outfile] (Parameter 4) |
outfile | Whitehead primer3_core program output file | Output file | <*>.primersearch |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-seqall" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_seqall |
integer | Start of each sequence to be used | Any integer value | 0 |
| -send1 -send_seqall |
integer | End of each sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_seqall |
boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_seqall |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_seqall |
boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_seqall |
boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_seqall |
boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_seqall |
boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_seqall |
string | Input sequence format | Any string | |
| -sdbname1 -sdbname_seqall |
string | Database name | Any string | |
| -sid1 -sid_seqall |
string | Entryname | Any string | |
| -ufo1 -ufo_seqall |
string | UFO features | Any string | |
| -fformat1 -fformat_seqall |
string | Features format | Any string | |
| -fopenfile1 -fopenfile_seqall |
string | Features file name | Any string | |
| "-outfile" associated outfile qualifiers | ||||
| -odirectory4 -odirectory_outfile |
string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
| -version | boolean | Report version number and exit | Boolean value Yes/No | N |
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
# This is my primer file D1S243 cacacaggctcacatgcc gctccagcgtcatggact D1S468 aattaaccgttttggtcct gcgacacacacttccc D1S2845 ccaaagggtgcttctc gtggcattccaacctc D1S1608 gatggcttttggggactatt cactgagccaagtgacacag D1S2893 aaaacatcaactctcccctg ctcaaaccccaataagcctt D1S2660 cacacatgcacatgcac agtgacaccagcaggg |
ID Z52466; SV 1; linear; genomic DNA; STS; HUM; 389 BP.
XX
AC Z52466;
XX
DT 18-MAR-1996 (Rel. 47, Created)
DT 09-SEP-2004 (Rel. 81, Last updated, Version 4)
XX
DE H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1;
DE single read.
XX
KW CA repeat; dinucleotide repeat; GT repeat; microsatellite DNA;
KW microsatellite marker; repeat polymorphism; STS.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC Homo.
XX
RN [1]
RP 1-389
RA Weissenbach J.;
RT ;
RL Submitted (01-SEP-1995) to the EMBL/GenBank/DDBJ databases.
RL Genethon, B.P. 60, 91002 Evry Cedex France. E-mail:
RL Jean.Weissenbach@genethon.fr
XX
RN [2]
RP 1-389
RX DOI; 10.1038/380152a0.
RX PUBMED; 8600387.
RA Dib C., Faure S., Fizames C., Samson D., Drouot N., Vignal A.,
RA Millasseau P., Marc S., Hazan J., Seboun E., Lathrop M., Gyapay G.,
RA Morissette J., Weissenbach J.;
RT "A comprehensive genetic map of the human genome based on 5,264
RT microsatellites";
RL Nature 380(6570):152-154(1996).
XX
DR GDB; 606855.
XX
CC full automatic;
XX
FH Key Location/Qualifiers
FH
FT source 1..389
FT /organism="Homo sapiens"
FT /chromosome="1"
FT /mol_type="genomic DNA"
FT /clone_lib="genomic DNA"
FT /cell_line="CEPH 134702"
FT /note="cloning vector is M13mp18"
FT /db_xref="taxon:9606"
XX
SQ Sequence 389 BP; 118 A; 124 C; 86 G; 57 T; 4 other;
agctgtgtgc acacaacatg anggggcaca catgcacatg cacacatgcc cacatgcata 60
tgcacacaca cacacacaca cacacacaca ttcatgccca agcacgccca ccctcatgtc 120
tcaccatgtg cacataacac acagtcacat ataccctggc acacatgccc acatgcagac 180
acgaaacaca ggcccacgnt tncatgcaca caggtatggg cacacatacc atgcacacat 240
aangacaaat accaggccag acatgatttg cccctgctgg tgtcactgtt aagtgtgaca 300
gacaagcaga ggacacacac ccacctggga cgcggggctt caggagagag gcagacctaa 360
tagggcccgg attcggggct ggggaggct 389
//
|
The input primer file has the following format:
Comment lines start with a '#'
Lines with primer information have three fields separated by spaces or TAB characters. The columns contain:
Empty files will cause primersearch to note that no primers have been found, and to exit.
Primer name D1S243 Primer name D1S468 Primer name D1S2845 Primer name D1S1608 Primer name D1S2893 Primer name D1S2660 Amplimer 1 Sequence: Z52466 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp |
Primer name D1S243 Primer name D1S468 Primer name D1S2845 Primer name D1S1608 Primer name D1S2893 Primer name D1S2660 Amplimer 1 Sequence: Z52466 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 239 bp Amplimer 2 Sequence: Z52466 Z52466 H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read. CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches Amplimer length: 261 bp |
Every potential amplimer will be reported; if one primer matches the forward strand twice and the other matches the reverse strand only once, two potential amplimers are reported. If the reverse primer matches twice, four potential amplimers are reported.
This program is processor-intensive. You should probably not use it, for example, to search the whole of EMBL or even the human section of EMBL. It will take longer with more primer pairs and if mismatches are allowed.
| Program name | Description |
|---|---|
| eprimer3 | Picks PCR primers and hybridization oligos |
| eprimer32 | Picks PCR primers and hybridization oligos |
| stssearch | Search a DNA database for matches with a set of STS primers |
stssearch does something similar, but doesn't allow you to find mismatches and will report any match in any orientation and doesn't require you to have both primers matching.
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.