|
|
vrnalalifoldpf |
Please help by correcting and extending the Wiki pages.
Calculates locally stable secondary structures for a set of aligned RNAs. The program reads aligned RNA sequences and calculates locally stable RNA secondary structure with a maximal base pair span.
Uses the Turner 2004 Nearest Neighbor model.
% vrnalalifoldpf Locally stable 2ry structures for a set of aligned RNAs Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnalalifoldpf]: |
Go to the input files for this example
Go to the output files for this example
Locally stable 2ry structures for a set of aligned RNAs
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) nucleotide sequence set filename
and optional format, or reference (input
USA)
[-outfile] outfile [*.vrnalalifoldpf] Vienna RNAfold output
file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-paramfile infile Vienna RNA parameters file (optional)
-rsumfile infile Vienna RNA Ribosum file (optional)
-separation integer [70] Maximum allowed separation of a base
pair to span (Any integer value)
-csv boolean [N] Output comma-separated values
-cutoff float [0.0005] Report only bps with an avg prob >
cutoff in dotplot (Any numeric value)
-scale float [1.07] Estimate of ensemble free energy (Any
numeric value)
-most boolean [N] Use most informative sequence algorithm
-temperature float [37.0] Temperature (Any numeric value)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-dangles menu [2] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-[no]lp boolean [Y] Allow lonely pairs
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-nsbases string Non-standard bases (Any string)
-energy menu [0] Rarely used option to fold sequences
from the ABCD... alphabet (Values: 0 (BP); 1
(Any with GC); 2 (Any with AU parameters))
-covariance float [1.0] Weight for covariance (Any numeric
value)
-nfactor float [1.0] Penalty for non-compatible seqs in
covariance (Any numeric value)
-alignoutfile outfile [*.vrnalalifoldpf] Vienna RNA alignment
output file
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
"-alignoutfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-sequence] (Parameter 1) |
seqset | (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnalalifoldpf | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -rsumfile | infile | Vienna RNA Ribosum file (optional) | Input file | Required | ||||||||
| -separation | integer | Maximum allowed separation of a base pair to span | Any integer value | 70 | ||||||||
| -csv | boolean | Output comma-separated values | Boolean value Yes/No | No | ||||||||
| -cutoff | float | Report only bps with an avg prob > cutoff in dotplot | Any numeric value | 0.0005 | ||||||||
| -scale | float | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
| -most | boolean | Use most informative sequence algorithm | Boolean value Yes/No | No | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -dangles | list | Method |
|
2 | ||||||||
| -[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -nsbases | string | Non-standard bases | Any string | |||||||||
| -energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
| -covariance | float | Weight for covariance | Any numeric value | 1.0 | ||||||||
| -nfactor | float | Penalty for non-compatible seqs in covariance | Any numeric value | 1.0 | ||||||||
| -alignoutfile | outfile | Vienna RNA alignment output file | Output file | <*>.vrnalalifoldpf | ||||||||
| Associated qualifiers | ||||||||||||
| "-sequence" associated seqset qualifiers | ||||||||||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 | ||||||||
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 | ||||||||
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||
| -sid1 -sid_sequence |
string | Entryname | Any string | |||||||||
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||
| -fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
| "-alignoutfile" associated outfile qualifiers | ||||||||||||
| -odirectory | string | Output directory | Any string | |||||||||
| General qualifiers | ||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||
>X01238.1/1-183 AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AL627277.1/108623-108805 AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AJ414145.1/90993-91174 AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGACGGCA.CC.UCGGAG.AUCC >U32767.1/6538-6734 .AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG CAGCGGCACUC.UGGGGU.CUUC >AE006208.1/8365-8185 .AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG CAGCGGCA.UC.UCGGGUUCUUC >Y00334.1/77-254 CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA CAGCGGCA.CGACCGGGG.AGCU >AE004317.1/5626-5807 UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU CAACGGCA.UC.CCGGGG.UUC. |
AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC |
7 sequence; length of alignment 203 alifold output |
| Program name | Description |
|---|---|
| banana | Plot bending and curvature data for B-DNA |
| btwisted | Calculate the twisting in a B-DNA sequence |
| einverted | Finds inverted repeats in nucleotide sequences |
| ovrnaalifold | RNA alignment folding |
| ovrnaalifoldpf | RNA alignment folding with partition |
| ovrnacofold | RNA cofolding |
| ovrnacofoldconc | RNA cofolding with concentrations |
| ovrnacofoldpf | RNA cofolding with partitioning |
| ovrnadistance | RNA distances |
| ovrnaduplex | RNA duplex calculation |
| ovrnaeval | RNA eval |
| ovrnaevalpair | RNA eval with cofold |
| ovrnafold | Calculate secondary structures of RNAs |
| ovrnafoldpf | Secondary structures of RNAs with partition |
| ovrnaheat | RNA melting |
| ovrnainverse | RNA sequences matching a structure |
| ovrnalfold | Calculate locally stable secondary structures of RNAs |
| ovrnaplot | Plot vrnafold output |
| ovrnasubopt | Calculate RNA suboptimals |
| sirna | Finds siRNA duplexes in mRNA |
| vrna2dfold | Structures and samples of k,l neighbourhoods |
| vrnaaliduplex | RNA duplex calculation for two sequence alignments |
| vrnaalifold | RNA alignment folding |
| vrnaalifoldpf | RNA alignment folding with partition |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnalfoldz | Locally stable secondary structures of RNAs plus zscore |
| vrnapkplex | RNA structures plus pseudoknots |
| vrnaplfold | Locally stable RNA 2ry structures - pair probabilities |
| vrnaplot | Plot vrnafold output |
| vrnasubopt | Calculate RNA suboptimals |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.