|
|
vrnaalifoldpf |
Please help by correcting and extending the Wiki pages.
This is a port of the Vienna RNA package program RNAalifold.
It reads aligned RNA sequences and calculates their minimum free energy (mfe) structure, partition function (pf) and base pairing probability matrix. It returns the mfe structure in bracket notation, its energy, the free energy of the thermodynamic ensemble and the frequency of the mfe structure in the ensemble. It also produces plots of the resulting secondary structure graph and a "dot plot" of the base pairing matrix.
The original program produces different outputs, depending on the options selected. In the EMBASSY implementation it is split into vrnaalifold and vrnaalifoldpf
% vrnaalifoldpf RNA alignment folding with partition Input (aligned) nucleotide sequence set: ecoli6s.fasta Vienna RNAfold output file [ecoli6s.vrnaalifoldpf]: |
Go to the input files for this example
Go to the output files for this example
RNA alignment folding with partition
Version: EMBOSS:6.4.0.0
Standard (Mandatory) qualifiers:
[-sequence] seqset (Aligned) nucleotide sequence set filename
and optional format, or reference (input
USA)
[-outfile] outfile [*.vrnaalifoldpf] Vienna RNAfold output file
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
-constraintfile infile Vienna RNA structure constraints file
(optional)
-paramfile infile Vienna RNA parameters file (optional)
-rsumfile infile Vienna RNA Ribosum file (optional)
-temperature float [37.0] Temperature (Any numeric value)
-[no]gu boolean [Y] Allow GU pairs
-[no]closegu boolean [Y] Allow GU pairs at end of helices
-[no]lp boolean [Y] Allow lonely pairs
-[no]convert boolean [Y] Convert T to U
-nsbases string Non-standard bases (Any string)
-[no]tetraloop boolean [Y] Stabilizing energies for tetra-loops
-circular boolean [N] Circular RNA
-colour boolean [N] Colour structure plot
-[no]alnps boolean [Y] Produce alignment postscript
-mea boolean [N] Calculate MEA sructure
-gammamea float [1.0] Gamma value for MEA (Any numeric
value)
-nback integer [0] Number of stochastic backtraces to
display (Any integer value)
-showenergy boolean [N] Show energy probabilities of stochastic
backtraces
-energy menu [0] Rarely used option to fold sequences
from the ABCD... alphabet (Values: 0 (BP); 1
(Any with GC); 2 (Any with AU parameters))
-scale float [1.07] Estimate of ensemble free energy (Any
numeric value)
-dangles menu [2] Method (Values: 0 (Ignore); 1 (Only
unpaired bases for just one dangling end); 2
(Always use dangling energies); 3 (Allow
coaxial stacking of adjacent helices))
-covariance float [1.0] Weight for covariance (Any numeric
value)
-nspenalty float [1.0] Non-compatible sequence penalty (Any
numeric value)
-endgaps boolean [N] Mark end gaps
-most boolean [N] Use most informative sequence algorithm
-ribosumscore boolean [N] Use ribosum scoring matrix
-old boolean [N] Use old energy evaluation (gaps as
chars)
-ssoutfile outfile [*.vrnaalifoldpf] Vienna RNA structure
postscript output file
-dotoutfile outfile [*.vrnaalifoldpf] Vienna dotplot postscript
output file (optional)
-alignoutfile outfile [*.vrnaalifoldpf] Vienna RNA alignment
postscript output file
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
"-ssoutfile" associated qualifiers
-odirectory string Output directory
"-dotoutfile" associated qualifiers
-odirectory string Output directory
"-alignoutfile" associated qualifiers
-odirectory string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write first file to standard output
-filter boolean Read first file from standard input, write
first file to standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options and exit. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report dying program messages
-version boolean Report version number and exit
|
| Qualifier | Type | Description | Allowed values | Default | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||||||||||
| [-sequence] (Parameter 1) |
seqset | (Aligned) nucleotide sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | ||||||||
| [-outfile] (Parameter 2) |
outfile | Vienna RNAfold output file | Output file | <*>.vrnaalifoldpf | ||||||||
| Additional (Optional) qualifiers | ||||||||||||
| (none) | ||||||||||||
| Advanced (Unprompted) qualifiers | ||||||||||||
| -constraintfile | infile | Vienna RNA structure constraints file (optional) | Input file | Required | ||||||||
| -paramfile | infile | Vienna RNA parameters file (optional) | Input file | Required | ||||||||
| -rsumfile | infile | Vienna RNA Ribosum file (optional) | Input file | Required | ||||||||
| -temperature | float | Temperature | Any numeric value | 37.0 | ||||||||
| -[no]gu | boolean | Allow GU pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]closegu | boolean | Allow GU pairs at end of helices | Boolean value Yes/No | Yes | ||||||||
| -[no]lp | boolean | Allow lonely pairs | Boolean value Yes/No | Yes | ||||||||
| -[no]convert | boolean | Convert T to U | Boolean value Yes/No | Yes | ||||||||
| -nsbases | string | Non-standard bases | Any string | |||||||||
| -[no]tetraloop | boolean | Stabilizing energies for tetra-loops | Boolean value Yes/No | Yes | ||||||||
| -circular | boolean | Circular RNA | Boolean value Yes/No | No | ||||||||
| -colour | boolean | Colour structure plot | Boolean value Yes/No | No | ||||||||
| -[no]alnps | boolean | Produce alignment postscript | Boolean value Yes/No | Yes | ||||||||
| -mea | boolean | Calculate MEA sructure | Boolean value Yes/No | No | ||||||||
| -gammamea | float | Gamma value for MEA | Any numeric value | 1.0 | ||||||||
| -nback | integer | Number of stochastic backtraces to display | Any integer value | 0 | ||||||||
| -showenergy | boolean | Show energy probabilities of stochastic backtraces | Boolean value Yes/No | No | ||||||||
| -energy | list | Rarely used option to fold sequences from the ABCD... alphabet |
|
0 | ||||||||
| -scale | float | Estimate of ensemble free energy | Any numeric value | 1.07 | ||||||||
| -dangles | list | Method |
|
2 | ||||||||
| -covariance | float | Weight for covariance | Any numeric value | 1.0 | ||||||||
| -nspenalty | float | Non-compatible sequence penalty | Any numeric value | 1.0 | ||||||||
| -endgaps | boolean | Mark end gaps | Boolean value Yes/No | No | ||||||||
| -most | boolean | Use most informative sequence algorithm | Boolean value Yes/No | No | ||||||||
| -ribosumscore | boolean | Use ribosum scoring matrix | Boolean value Yes/No | No | ||||||||
| -old | boolean | Use old energy evaluation (gaps as chars) | Boolean value Yes/No | No | ||||||||
| -ssoutfile | outfile | Vienna RNA structure postscript output file | Output file | <*>.vrnaalifoldpf | ||||||||
| -dotoutfile | outfile | Vienna dotplot postscript output file (optional) | Output file | <*>.vrnaalifoldpf | ||||||||
| -alignoutfile | outfile | Vienna RNA alignment postscript output file | Output file | <*>.vrnaalifoldpf | ||||||||
| Associated qualifiers | ||||||||||||
| "-sequence" associated seqset qualifiers | ||||||||||||
| -sbegin1 -sbegin_sequence |
integer | Start of each sequence to be used | Any integer value | 0 | ||||||||
| -send1 -send_sequence |
integer | End of each sequence to be used | Any integer value | 0 | ||||||||
| -sreverse1 -sreverse_sequence |
boolean | Reverse (if DNA) | Boolean value Yes/No | N | ||||||||
| -sask1 -sask_sequence |
boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | ||||||||
| -snucleotide1 -snucleotide_sequence |
boolean | Sequence is nucleotide | Boolean value Yes/No | N | ||||||||
| -sprotein1 -sprotein_sequence |
boolean | Sequence is protein | Boolean value Yes/No | N | ||||||||
| -slower1 -slower_sequence |
boolean | Make lower case | Boolean value Yes/No | N | ||||||||
| -supper1 -supper_sequence |
boolean | Make upper case | Boolean value Yes/No | N | ||||||||
| -sformat1 -sformat_sequence |
string | Input sequence format | Any string | |||||||||
| -sdbname1 -sdbname_sequence |
string | Database name | Any string | |||||||||
| -sid1 -sid_sequence |
string | Entryname | Any string | |||||||||
| -ufo1 -ufo_sequence |
string | UFO features | Any string | |||||||||
| -fformat1 -fformat_sequence |
string | Features format | Any string | |||||||||
| -fopenfile1 -fopenfile_sequence |
string | Features file name | Any string | |||||||||
| "-outfile" associated outfile qualifiers | ||||||||||||
| -odirectory2 -odirectory_outfile |
string | Output directory | Any string | |||||||||
| "-ssoutfile" associated outfile qualifiers | ||||||||||||
| -odirectory | string | Output directory | Any string | |||||||||
| "-dotoutfile" associated outfile qualifiers | ||||||||||||
| -odirectory | string | Output directory | Any string | |||||||||
| "-alignoutfile" associated outfile qualifiers | ||||||||||||
| -odirectory | string | Output directory | Any string | |||||||||
| General qualifiers | ||||||||||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | ||||||||
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | ||||||||
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | ||||||||
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | ||||||||
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | ||||||||
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | ||||||||
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | ||||||||
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | ||||||||
| -error | boolean | Report errors | Boolean value Yes/No | Y | ||||||||
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | ||||||||
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | ||||||||
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | ||||||||
>X01238.1/1-183 AUUUCUCUGAGAUGUUCGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUCCGU...............CCGAGA AGCCUUAAAACUGCGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AL627277.1/108623-108805 AUUUCUCUGAGAUGUUUGCAAGCGGGC.CAGUCCCCUGAGCCGAUAUUUCAUACCACAAG AAUGUGGCGCUCCGCGGUUGGUGAGCAUGCUCGGUUCGU...............CCGAGA AGCCUUAAAACUGUGACGACACAUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGGCGGCA.UC.UCGGAG.AUUC >AJ414145.1/90993-91174 AUUUCUCUGAGGUGUUUGCCAGCGGGC.CAGUCCCCUGAGCCGAUAUUUAAUACCAACAG AAUGUAGUGCUCCGUAACCGGUGAGCAUGCUCGGUCCG................CCGAGA AGCCUUAAGGUUGCGACGCUGCGUUCACCUUGAACCAA.GGGUUCAAGGGUUACAGCCUG CGACGGCA.CC.UCGGAG.AUCC >U32767.1/6538-6734 .AUUACCUGGAGUGUUCGUCAGUAGGC.UAUGUCCCUGAGCCGAUACUUUAAAUCUUAUA AAUU.GGUUUCCUAUCGUUGGUGUGUAGGCUUAACCUUUGACUCGUUCAUUGGGCUAAGA AACCUGAAAACGGUAUCAACUGAUUU.CCUUGAACCGUCGGGUUCAAGGACUACUGCCCG CAGCGGCACUC.UGGGGU.CUUC >AE006208.1/8365-8185 .AUUACCUGAGGUGUUUGCCAGUGGGU.UAUGUCCCUGAGCCGAUACUUU.UAUUUUAUG AAUC.GGUUUCUAAUUGUUGGUGUGCAUGCUUAGCUUGA...............CUAAGA AGCCUAAAAAUAGUUAUAACUGAUUC.CCUUGAACCGUUGGGUUCAAGGACUGAGACUUG CAGCGGCA.UC.UCGGGUUCUUC >Y00334.1/77-254 CGCUCCCUGGUGUGUUGGCCAGUCGGU.GAUGUCCCUGAGCCGAUAACUGCAACAAC..G GAGGUUGC.CAGUUGGACCGGUGUGCAUGUCCGCACG.................ACGGAA AGCCUUAAGGUCUAC.UGCAACCGCCACCUUGAACUUUCGGGUUCAAGGGCUA.ACCCGA CAGCGGCA.CGACCGGGG.AGCU >AE004317.1/5626-5807 UUUACCCUGGGGUGUUCGUCAGCGGAUUUAUGUCCCUGAGCCGAUAAGCAACAUAAC..A GGGUUGGUAUUGGGUAGCUAUUGAGCAAGCUCGGCUUGUA..............CCGAGA AGCCUGCGGUUACCAUUACUGAUCCG.CCUUGAACCUGAUGGUUCAAGGGCUACGAUCCU CAACGGCA.UC.CCGGGG.UUC. |
![[vrnaalifoldpf results]](vrnaalifoldpf.1.ecoli6s.ss.gif)
![[vrnaalifoldpf results]](vrnaalifoldpf.1.ecoli6s.gif)
![[vrnaalifoldpf results]](vrnaalifoldpf.1.ecoli6s.alirna.gif)
AUUUCCCUGAGGUGUUCGCCAGCGGGC_CAUGUCCCUGAGCCGAUAUUUAAUACCACAAGAAUGUGGUGCUCCGUGGUUGGUGAGCAUGCUCGGCCCGU_______________CCGAGAAGCCUUAAAAUUGCGACGACACAUUCACCUUGAACCAA_GGGUUCAAGGGCUACAGCCUGCAGCGGCA_UC_UCGGGG_AUUC
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... (-65.91 = -57.83 + -8.08)
...((((((((((({{(((..((((((................................(((((((......(((((((...,.((...(((((....................)))))..)),....)))))))..,.))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... [-68.19]
frequency of mfe structure in ensemble 0.0247624
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)... -65.91 {-57.83 + -8.08}
7 sequences; length of alignment 203
alifold output
64 142 0 100.0% 0.000 CG:1 GC:4 UG:1 UA:1
63 143 0 100.0% 0.001 GC:1 GU:1 UG:1 UA:4
74 134 0 99.9% 0.002 GC:3 GU:1 AU:2 UA:1
10 193 0 100.0% 0.001 GC:2 GU:1 AU:4
77 131 0 100.0% 0.001 GC:3 GU:2 AU:2
12 190 0 100.0% 0.001 GC:2 GU:3 AU:2
66 140 0 98.6% 0.043 GC:4 GU:1 AU:1 UA:1
76 132 1 99.9% 0.003 CG:1 GC:1 GU:2 AU:1 UA:1
6 197 0 100.0% 0.000 CG:4 UA:3
92 117 0 100.0% 0.000 CG:5 UA:2
25 178 0 100.0% 0.003 GC:6 GU:1
26 177 0 100.0% 0.003 GC:6 AU:1
91 118 0 100.0% 0.001 CG:1 UA:6
93 116 0 100.0% 0.001 GC:5 AU:2
79 129 0 98.8% 0.067 CG:2 UG:1 UA:4
61 145 0 99.8% 0.008 GC:2 AU:5
5 198 0 99.7% 0.008 CG:5 AU:2
65 141 0 99.6% 0.011 UG:2 UA:3 --:2
75 133 1 99.9% 0.002 CG:2 GU:1 UG:3
23 180 1 99.9% 0.003 CG:3 UG:2 UA:1
24 179 1 99.9% 0.006 CG:1 GC:1 GU:4
90 119 0 99.1% 0.026 CG:6 UA:1
7 196 0 100.0% 0.000 CG:7
11 191 1 100.0% 0.001 GC:5 UG:1
14 187 0 99.9% 0.002 GC:7
13 188 0 99.9% 0.003 UA:7
62 144 1 99.9% 0.005 GC:1 AU:5
8 195 0 99.8% 0.006 UG:7
22 181 0 99.7% 0.010 GC:7
78 130 1 99.6% 0.027 CG:2 UA:4
9 194 1 99.9% 0.002 GC:6
18 184 0 99.4% 0.019 GC:7
19 183 1 98.6% 0.050 CG:4 UG:1 UA:1
27 176 1 98.2% 0.057 CG:4 UA:2
156 161 0 95.7% 0.267 CG:6 UG:1
60 146 1 96.2% 0.116 GC:5 AU:1
152 165 0 96.2% 0.327 GC:7
155 162 0 96.2% 0.244 CG:7
153 164 0 96.1% 0.251 AU:7
154 163 0 96.1% 0.253 AU:7
94 115 2 96.7% 0.097 GC:5
151 166 0 96.0% 0.301 UA:7
150 167 0 95.2% 0.209 UA:7
[Part of this file has been deleted for brevity]
34 40 0 1.1% 0.204 CG:7 +
53 151 0 1.1% 0.179 AU:7 +
35 40 0 1.0% 0.228 CG:7 +
146 170 2 1.3% 0.736 CG:4 UA:1 +
40 47 2 1.3% 0.335 GC:2 GU:3 +
38 42 0 0.9% 0.260 GC:7 +
85 124 0 0.7% 0.564 GC:7 +
37 43 0 0.7% 0.372 UG:7 +
48 157 1 0.1% 0.206 GU:1 UG:2 UA:3 +
52 152 2 1.0% 0.147 CG:1 UG:4 +
47 160 1 0.1% 0.134 CG:2 UG:3 AU:1 +
37 44 0 0.5% 0.211 UA:7 +
35 43 0 0.5% 0.193 CG:7 +
39 45 0 0.4% 0.076 AU:7 +
36 40 0 0.3% 0.186 CG:7 +
37 46 0 0.3% 0.204 UA:7 +
34 38 0 0.3% 0.161 CG:7 +
38 45 0 0.2% 0.216 GU:7 +
40 48 1 0.2% 0.325 GC:1 GU:5 +
30 172 0 0.2% 0.130 AU:7 +
43 48 1 0.1% 0.334 GC:1 GU:5 +
84 126 2 0.1% 0.095 UG:1 AU:3 UA:1 +
67 140 1 0.1% 0.046 GC:4 GU:2 +
53 150 0 0.1% 0.044 AU:7 +
45 53 0 0.1% 0.069 UA:7 +
36 169 0 0.1% 0.439 CG:7 +
79 128 2 0.3% 0.048 UG:1 UA:4 +
80 124 1 0.4% 0.067 GC:6 +
55 152 2 0.2% 0.126 CG:4 UG:1 +
81 123 1 0.4% 0.066 GC:6 +
82 127 1 0.4% 0.083 UA:6 +
44 49 1 0.3% 0.205 AU:6 +
38 55 2 0.1% 0.293 GC:4 GU:1 +
19 182 2 0.1% 0.026 CG:3 UA:2 +
70 135 2 0.1% 0.024 CG:3 UA:2 +
171 175 2 0.1% 0.384 CG:2 UA:3 +
43 55 2 0.1% 0.290 GC:4 GU:1 +
31 47 2 0.1% 0.021 GU:3 UA:2 +
151 157 2 0.1% 0.146 UG:2 UA:3 +
81 124 1 0.2% 0.082 GC:6 +
49 153 1 0.2% 0.167 UA:6 +
39 49 1 0.1% 0.188 AU:6 +
81 125 1 0.1% 0.070 GU:6 +
35 170 2 0.3% 0.604 CG:5 +
49 154 1 0.1% 0.171 UA:6 +
56 151 2 0.2% 0.109 AU:5 +
44 48 2 0.2% 0.168 AU:5 +
48 154 2 0.1% 0.149 UA:5 +
148 170 2 0.1% 0.713 CG:5 +
37 56 2 0.1% 0.198 UA:5 +
...((((((((((((.(((..((((((................................(((((((......(((((((.....((...(((((....................)))))..)).....)))))))....))))))).(((((((((....)))))))))......)))))).)))))).)).)))))).)...
|
| Program name | Description |
|---|---|
| banana | Plot bending and curvature data for B-DNA |
| btwisted | Calculate the twisting in a B-DNA sequence |
| einverted | Finds inverted repeats in nucleotide sequences |
| ovrnaalifold | RNA alignment folding |
| ovrnaalifoldpf | RNA alignment folding with partition |
| ovrnacofold | RNA cofolding |
| ovrnacofoldconc | RNA cofolding with concentrations |
| ovrnacofoldpf | RNA cofolding with partitioning |
| ovrnadistance | RNA distances |
| ovrnaduplex | RNA duplex calculation |
| ovrnaeval | RNA eval |
| ovrnaevalpair | RNA eval with cofold |
| ovrnafold | Calculate secondary structures of RNAs |
| ovrnafoldpf | Secondary structures of RNAs with partition |
| ovrnaheat | RNA melting |
| ovrnainverse | RNA sequences matching a structure |
| ovrnalfold | Calculate locally stable secondary structures of RNAs |
| ovrnaplot | Plot vrnafold output |
| ovrnasubopt | Calculate RNA suboptimals |
| sirna | Finds siRNA duplexes in mRNA |
| vrna2dfold | Structures and samples of k,l neighbourhoods |
| vrnaaliduplex | RNA duplex calculation for two sequence alignments |
| vrnaalifold | RNA alignment folding |
| vrnacofold | RNA cofolding |
| vrnacofoldconc | RNA cofolding with concentrations |
| vrnacofoldpf | RNA cofolding with partitioning |
| vrnadistance | RNA distances |
| vrnaduplex | RNA duplex calculation |
| vrnaeval | RNA eval |
| vrnaevalpair | RNA eval with cofold |
| vrnafold | Calculate secondary structures of RNAs |
| vrnafoldpf | Secondary structures of RNAs with partition |
| vrnaheat | RNA melting |
| vrnainverse | RNA sequences matching a structure |
| vrnalalifoldpf | Locally stable 2ry structures for a set of aligned RNAs |
| vrnalfold | Calculate locally stable secondary structures of RNAs |
| vrnalfoldz | Locally stable secondary structures of RNAs plus zscore |
| vrnapkplex | RNA structures plus pseudoknots |
| vrnaplfold | Locally stable RNA 2ry structures - pair probabilities |
| vrnaplot | Plot vrnafold output |
| vrnasubopt | Calculate RNA suboptimals |
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.