Appdoc:Featreport
From EMBOSS
Contents |
Function
Reads and writes a feature table
Description
featreport reads a sequence and a feature table and writes a standard report output.
Usage
Here is a sample session with featreport
% featreport Reads and writes a feature table Input sequence: paamir.fasta Input features: paamir.gff Output report [x13776.featreport]: test.out
Go to the input files for this example
Go to the output files for this example
Command line arguments
| Qualifier | Type | Description | Allowed values | Default |
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) | sequence | Sequence filename and optional format, or reference (input USA) | Readable sequence | Required |
| [-features] (Parameter 2) | features | (no help text) features value | Readable feature table | Required |
| [-outfile] (Parameter 3) | report | Output report file name | Report output file | <*>.featreport |
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated sequence qualifiers | ||||
| -sbegin1 -sbegin_sequence | integer | Start of the sequence to be used | Any integer value | 0 |
| -send1 -send_sequence | integer | End of the sequence to be used | Any integer value | 0 |
| -sreverse1 -sreverse_sequence | boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| -sask1 -sask_sequence | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N |
| -snucleotide1 -snucleotide_sequence | boolean | Sequence is nucleotide | Boolean value Yes/No | N |
| -sprotein1 -sprotein_sequence | boolean | Sequence is protein | Boolean value Yes/No | N |
| -slower1 -slower_sequence | boolean | Make lower case | Boolean value Yes/No | N |
| -supper1 -supper_sequence | boolean | Make upper case | Boolean value Yes/No | N |
| -sformat1 -sformat_sequence | string | Input sequence format | Any string | |
| -sdbname1 -sdbname_sequence | string | Database name | Any string | |
| -sid1 -sid_sequence | string | Entryname | Any string | |
| -ufo1 -ufo_sequence | string | UFO features | Any string | |
| -fformat1 -fformat_sequence | string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence | string | Features file name | Any string | |
| "-features" associated features qualifiers | ||||
| -fformat2 -fformat_features | string | Features format | Any string | |
| -fopenfile2 -fopenfile_features | string | Features file name | Any string | |
| -fask2 -fask_features | boolean | Prompt for begin/end/reverse | Boolean value Yes/No | N |
| -fbegin2 -fbegin_features | integer | Start of the features to be used | Any integer value | 0 |
| -fend2 -fend_features | integer | End of the features to be used | Any integer value | 0 |
| -freverse2 -freverse_features | boolean | Reverse (if DNA) | Boolean value Yes/No | N |
| "-outfile" associated report qualifiers | ||||
| -rformat3 -rformat_outfile | string | Report format | Any string | gff |
| -rname3 -rname_outfile | string | Base file name | Any string | |
| -rextension3 -rextension_outfile | string | File name extension | Any string | |
| -rdirectory3 -rdirectory_outfile | string | Output directory | Any string | |
| -raccshow3 -raccshow_outfile | boolean | Show accession number in the report | Boolean value Yes/No | N |
| -rdesshow3 -rdesshow_outfile | boolean | Show description in the report | Boolean value Yes/No | N |
| -rscoreshow3 -rscoreshow_outfile | boolean | Show the score in the report | Boolean value Yes/No | Y |
| -rstrandshow3 -rstrandshow_outfile | boolean | Show the nucleotide strand in the report | Boolean value Yes/No | Y |
| -rusashow3 -rusashow_outfile | boolean | Show the full USA in the report | Boolean value Yes/No | N |
| -rmaxall3 -rmaxall_outfile | integer | Maximum total hits to report | Any integer value | 0 |
| -rmaxseq3 -rmaxseq_outfile | integer | Maximum hits to report for one sequence | Any integer value | 0 |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N |
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N |
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N |
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N |
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N |
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y |
| -help | boolean | Report command line options. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N |
| -warning | boolean | Report warnings | Boolean value Yes/No | Y |
| -error | boolean | Report errors | Boolean value Yes/No | Y |
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y |
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y |
Input file format
featreport reads any normal sequence USAs and features UFOs.
Input example
File: paamir.fasta
>X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac aggagaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt ccgccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcg cgagttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgca gctgatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgt gccggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccc cgcggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcga tgcccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaa gctgaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaacca ggccaaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctggg aaacgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgt catcatgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctg gttgctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgct gagcgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagtt cctcgag
File: paamir.gff
##gff-version 2.0 ##date 2003-02-14 ##Type DNA PAAMIR PAAMIR EMBL source 1 2167 0.000 + . Sequence "PAAMIR.1" ; db_xref "taxon:287" ; organism "Pseudomonas aeruginosa" ; strain "PAC" ; isolate "PAC 1" ; map "38 min" PAAMIR EMBL CDS 1289 1879 0.000 + . Sequence "PAAMIR.2" ; db_xref "SWISS-PROT:P10932" ; note "aliphatic amidase regulator, positive regulator of amiE" ; transl_table 11 ; gene "amiR" ; protein_id "CAA32023.1" ; translation "MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + . Sequence "PAAMIR.3" ; db_xref "SWISS-PROT:P27017" ; note "negative regulator of amiR" ; transl_table 11 ; gene "amiC" ; protein_id "CAA32024.1" ; translation "MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . Sequence "PAAMIR.4" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . Sequence "PAAMIR.5" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL RBS 121 126 0.000 + . Sequence "PAAMIR.6" ; note "proposed Shine-Dalgarno sequence" PAAMIR EMBL variation 912 1167 0.000 + . Sequence "PAAMIR.7" ; note "ClaI fragment deleted in pSW36, constitutive phenotype" ; replace "" ; gene "amiC" PAAMIR EMBL misc_feature 1 1 0.000 + . Sequence "PAAMIR.8" ; FeatFlags "0x40" ; note "last base of an XhoI site" PAAMIR EMBL misc_feature 648 653 0.000 + . Sequence "PAAMIR.9" ; note "end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL conflict 1281 1281 0.000 + . Sequence "PAAMIR.10" ; FeatFlags "0x40" ; replace "g" ; citation [3]
Output file format
featreport outputs a report format file.
Output example
File: test.out
##gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2009-07-15 #!Type DNA #!Source-version EMBOSS 6.1.0 PAAMIR EMBL databank_entry 1 2167 0.000 + . ID="PAAMIR.1";db_xref="taxon:287";organism="Pseudomonas aeruginosa";strain="PAC";isolate="PAC 1";map="38 min" PAAMIR EMBL CDS 1289 1879 0.000 + 0 ID="PAAMIR.2";db_xref="SWISS-PROT:P10932";note="aliphatic amidase regulator, positive regulator of amiE";transl_table=11;gene="amiR";protein_id="CAA32023.1";translation="MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + 0 ID="PAAMIR.3";db_xref="SWISS-PROT:P27017";note="negative regulator of amiR";transl_table=11;gene="amiC";protein_id="CAA32024.1";translation="MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . ID="PAAMIR.4";note="proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . ID="PAAMIR.5";note="proposed rpoN-dependent promoter" PAAMIR EMBL ribosome_entry_site 121 126 0.000 + . ID="PAAMIR.6";note="proposed Shine-Dalgarno sequence" PAAMIR EMBL sequence_variant 912 1167 0.000 + . ID="PAAMIR.7";note="ClaI fragment deleted in pSW36, constitutive phenotype";replace="";gene="amiC" PAAMIR EMBL sequence_feature 1 1 0.000 + . ID="PAAMIR.8";featflags="0x40";note="last base of an XhoI site" PAAMIR EMBL sequence_feature 648 653 0.000 + . ID="PAAMIR.9";note="end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL sequence_conflict 1281 1281 0.000 + . ID="PAAMIR.10";featflags="0x40";replace="g";citation=[3]
Data files
None.
Notes
None.
References
None.
Warnings
None.
Diagnostic Error Messages
None.
Exit status
It always exits with status 0.
Known bugs
None.
See also
| aligncopy | Reads and writes alignments |
| aligncopypair | Reads and writes pairs from alignments |
| biosed | Replace or delete sequence sections |
| codcopy | Copy and reformat a codon usage table |
| cutseq | Removes a section from a sequence |
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Retrieves sequence entries from flatfile databases and files |
| extractalign | Extract regions from a sequence alignment |
| extractfeat | Extract features from sequence(s) |
| extractseq | Extract regions from a sequence |
| featcopy | Reads and writes a feature table |
| listor | Write a list file of the logical OR of two sets of sequences |
| makenucseq | Create random nucleotide sequences |
| makeprotseq | Create random protein sequences |
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N |
| maskambigprot | Masks all ambiguity characters in protein sequences with X |
| maskfeat | Write a sequence with masked features |
| maskseq | Write a sequence with masked regions |
| newseq | Create a sequence file from a typed-in sequence |
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file |
| noreturn | Remove carriage return from ASCII files |
| nospace | Remove all whitespace from an ASCII text file |
| notab | Replace tabs with spaces in an ASCII text file |
| notseq | Write to file a subset of an input stream of sequences |
| nthseq | Write to file a single sequence from an input stream of sequences |
| nthseqset | Reads and writes (returns) one set of sequences from many |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a nucleotide sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsetall | Reads and writes (returns) many sets of sequences |
| seqretsplit | Reads sequences and writes them to individual files |
| sizeseq | Sort sequences by size |
| skipredundant | Remove redundant sequences from an input set |
| skipseq | Reads and writes (returns) sequences, skipping first few |
| splitsource | Split sequence(s) into original source sequences |
| splitter | Split sequence(s) into smaller sequences |
| trimest | Remove poly-A tails from nucleotide sequences |
| trimseq | Remove unwanted characters from start and end of sequence(s) |
| trimspace | Remove extra whitespace from an ASCII text file |
| union | Concatenate multiple sequences into a single sequence |
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) |
| yank | Add a sequence reference (a full USA) to a list file |
Author(s)
Peter Rice European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team (emboss-bug (@) emboss.open-bio.org) not to the original author.
History
Target users
This program is intended to be used by everyone and everything, from naive users to embedded scripts.
Comments
None
