Appdoc:Descseq

From EMBOSS

Contents 1 Function 2 Description 3 Usage 4 Command line arguments 5 Input file format 5.1 Input example 5.1.1 File: dna.text 6 Output file format 6.1 Output example 6.1.1 File: clone23.seq 6.2 Output example 2 6.2.1 File: xy24.seq 6.3 Output example 3 6.3.1 File: est4.seq 7 Data files 8 Notes 9 References 10 Warnings 11 Diagnostic Error Messages 12 Exit status 13 Known bugs 14 See also 15 Author(s) 16 History 17 Target users 18 Comments

Function

Alter the name or description of a sequence

Description

descseq reads a sequence and writes it to file but with a different name and / or description. All other records including the sequence itself are left unaltered.

Usage

Here is a sample session with descseq

Set the name of a sequence to "myclone23"

% descseq -seq dna.text -out clone23.seq -name 'myclone23' 
Alter the name or description of a sequence.

Go to the input files for this example
Go to the output files for this example

Example 2

Set the description of a sequence to "This is my clone number 244"

% descseq -seq dna.text -out xy24.seq -desc 'This is my clone number 244' 
Alter the name or description of a sequence.

Go to the output files for this example

Example 3

Append some text to the description of a sequence

% descseq -seq dna.text -out est4.seq -desc ' (submitted)' -append 
Alter the name or description of a sequence.

Go to the output files for this example

Command line arguments

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-sequence] (Parameter 1)	sequence	(Gapped) sequence filename and optional format, or reference (input USA)	Readable sequence	Required
[-outseq] (Parameter 2)	seqout	Sequence filename and optional format (output USA)	Writeable sequence	<*>.format
Additional (Optional) qualifiers
-name	string	Name of the sequence	Any string
-description	string	Description of the sequence	Any string
Advanced (Unprompted) qualifiers
-append	boolean	This allows you to append the name or description you have given on to the end of the existing name or description of the sequence.	Boolean value Yes/No	No
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin1 -sbegin_sequence	integer	Start of the sequence to be used	Any integer value	0
-send1 -send_sequence	integer	End of the sequence to be used	Any integer value	0
-sreverse1 -sreverse_sequence	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_sequence	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_sequence	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_sequence	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_sequence	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_sequence	boolean	Make upper case	Boolean value Yes/No	N
-sformat1 -sformat_sequence	string	Input sequence format	Any string
-sdbname1 -sdbname_sequence	string	Database name	Any string
-sid1 -sid_sequence	string	Entryname	Any string
-ufo1 -ufo_sequence	string	UFO features	Any string
-fformat1 -fformat_sequence	string	Features format	Any string
-fopenfile1 -fopenfile_sequence	string	Features file name	Any string
"-outseq" associated seqout qualifiers
-osformat2 -osformat_outseq	string	Output seq format	Any string
-osextension2 -osextension_outseq	string	File name extension	Any string
-osname2 -osname_outseq	string	Base file name	Any string
-osdirectory2 -osdirectory_outseq	string	Output directory	Any string
-osdbname2 -osdbname_outseq	string	Database name to add	Any string
-ossingle2 -ossingle_outseq	boolean	Separate file for each entry	Boolean value Yes/No	N
-oufo2 -oufo_outseq	string	UFO features	Any string
-offormat2 -offormat_outseq	string	Features format	Any string
-ofname2 -ofname_outseq	string	Features file name	Any string
-ofdirectory2 -ofdirectory_outseq	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y

Input file format

descseq reads a normal sequence USA.

Input example

File: dna.text

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
GTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output file format

descseq writes the sequence file with a changed name or description.

Output example

File: clone23.seq

>myclone23
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output example 2

File: xy24.seq

>EMBOSS_001 This is my clone number 244
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Output example 3

File: est4.seq

>EMBOSS_001  (submitted)
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

None.

Notes

Most sequence formats allow, at the very minimum, a name for the sequence and some comments to be stored in the sequence file. descseq let's you change the sequence name and / or description, and is far more convenient and less error-prone than using the editor for editing.

The default action is to replace the existing name or description with your new one, but by using the qualifier -append what you enter is appended to the existing name or description. Note that if you append to a description, no space is inserted by default bewteen the existing description and your appended text. You have to put in a space yourself if you require one.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None noted.

See also

aligncopy	Reads and writes alignments
aligncopypair	Reads and writes pairs from alignments
biosed	Replace or delete sequence sections
codcopy	Copy and reformat a codon usage table
cutseq	Removes a section from a sequence
degapseq	Removes non-alphabetic (e.g. gap) characters from sequences
entret	Retrieves sequence entries from flatfile databases and files
extractalign	Extract regions from a sequence alignment
extractfeat	Extract features from sequence(s)
extractseq	Extract regions from a sequence
featcopy	Reads and writes a feature table
featreport	Reads and writes a feature table
listor	Write a list file of the logical OR of two sets of sequences
makenucseq	Create random nucleotide sequences
makeprotseq	Create random protein sequences
maskambignuc	Masks all ambiguity characters in nucleotide sequences with N
maskambigprot	Masks all ambiguity characters in protein sequences with X
maskfeat	Write a sequence with masked features
maskseq	Write a sequence with masked regions
newseq	Create a sequence file from a typed-in sequence
nohtml	Remove mark-up (e.g. HTML tags) from an ASCII text file
noreturn	Remove carriage return from ASCII files
nospace	Remove all whitespace from an ASCII text file
notab	Replace tabs with spaces in an ASCII text file
notseq	Write to file a subset of an input stream of sequences
nthseq	Write to file a single sequence from an input stream of sequences
nthseqset	Reads and writes (returns) one set of sequences from many
pasteseq	Insert one sequence into another
revseq	Reverse and complement a nucleotide sequence
seqret	Reads and writes (returns) sequences
seqretsetall	Reads and writes (returns) many sets of sequences
seqretsplit	Reads sequences and writes them to individual files
sizeseq	Sort sequences by size
skipredundant	Remove redundant sequences from an input set
skipseq	Reads and writes (returns) sequences, skipping first few
splitsource	Split sequence(s) into original source sequences
splitter	Split sequence(s) into smaller sequences
trimest	Remove poly-A tails from nucleotide sequences
trimseq	Remove unwanted characters from start and end of sequence(s)
trimspace	Remove extra whitespace from an ASCII text file
union	Concatenate multiple sequences into a single sequence
vectorstrip	Removes vectors from the ends of nucleotide sequence(s)
yank	Add a sequence reference (a full USA) to a list file

Author(s)

Gary Williams formerly at MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug (@) emboss.open-bio.org) not to the original author.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None