abiview

Wiki

Please help by correcting and extending the Wiki pages.

Function

Description

abiview reads in an ABI sequencer trace file and graphically displays the data. The probabilities of each of the 4 nucleotide bases along the sequencing run is plotted and the assigned nucleotide (G, A, T, C or N) from the ABI file is overlayed on the graphs. The complete sequence is written to an output file.

Usage

% abiview -graph cps Display the trace in an ABI sequencer file ABI sequencing trace file: abiview.abi nucleotide output sequence [abiview.fasta]: Created abiview.ps

Go to the input files for this example
Go to the output files for this example

Command line arguments

Display the trace in an ABI sequencer file
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-infile]            infile     ABI sequencing trace file
  [-outseq]            seqout     [.] Nucleotide sequence
                                  filename and optional format (output USA)
   -graph              xygraph    [$EMBOSS_GRAPHICS value, or x11] Graph type
                                  (ps, hpgl, hp7470, hp7580, meta, cps, x11,
                                  tek, tekt, none, data, xterm, png, gif, pdf,
                                  svg)

   Additional (Optional) qualifiers:
   -startbase          integer    [0] First base to report or display (Integer
                                  0 or more)
   -endbase            integer    [0] Last sequence base to report or display.
                                  If the default is set to zero then the
                                  value of this is taken as the maximum number
                                  of bases. (Any integer value)
   -yticks             boolean    [N] Display y-axis ticks
   -[no]sequence       boolean    [Y] Display the sequence on the graph
   -window             integer    [40] Sequence display window size (Any
                                  integer value)
   -bases              string     [GATC] Base graphs to be displayed (Any
                                  string, matching regular expression
                                  /[GATC]+/)

   Advanced (Unprompted) qualifiers:
   -separate           boolean    [N] Separate the trace graphs for the 4
                                  bases

   Associated qualifiers:

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   "-graph" associated qualifiers
   -gprompt            boolean    Graph prompting
   -gdesc              string     Graph description
   -gtitle             string     Graph title
   -gsubtitle          string     Graph subtitle
   -gxtitle            string     Graph x axis title
   -gytitle            string     Graph y axis title
   -goutfile           string     Output file for non interactive displays
   -gdirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-infile] (Parameter 1)	infile	ABI sequencing trace file	Input file	Required
[-outseq] (Parameter 2)	seqout	Nucleotide sequence filename and optional format (output USA)	Writeable sequence	<*>.format
-graph	xygraph	Graph type	EMBOSS has a list of known devices, including ps, hpgl, hp7470, hp7580, meta, cps, x11, tek, tekt, none, data, xterm, png, gif, pdf, svg	EMBOSS_GRAPHICS value, or x11
Additional (Optional) qualifiers
-startbase	integer	First base to report or display	Integer 0 or more	0
-endbase	integer	Last sequence base to report or display. If the default is set to zero then the value of this is taken as the maximum number of bases.	Any integer value	0
-yticks	boolean	Display y-axis ticks	Boolean value Yes/No	No
-[no]sequence	boolean	Display the sequence on the graph	Boolean value Yes/No	Yes
-window	integer	Sequence display window size	Any integer value	40
-bases	string	Base graphs to be displayed	Any string, matching regular expression /[GATC]+/	GATC
Advanced (Unprompted) qualifiers
-separate	boolean	Separate the trace graphs for the 4 bases	Boolean value Yes/No	No
Associated qualifiers
"-outseq" associated seqout qualifiers
-osformat2 -osformat_outseq	string	Output seq format	Any string
-osextension2 -osextension_outseq	string	File name extension	Any string
-osname2 -osname_outseq	string	Base file name	Any string
-osdirectory2 -osdirectory_outseq	string	Output directory	Any string
-osdbname2 -osdbname_outseq	string	Database name to add	Any string
-ossingle2 -ossingle_outseq	boolean	Separate file for each entry	Boolean value Yes/No	N
-oufo2 -oufo_outseq	string	UFO features	Any string
-offormat2 -offormat_outseq	string	Features format	Any string
-ofname2 -ofname_outseq	string	Features file name	Any string
-ofdirectory2 -ofdirectory_outseq	string	Output directory	Any string
"-graph" associated xygraph qualifiers
-gprompt	boolean	Graph prompting	Boolean value Yes/No	N
-gdesc	string	Graph description	Any string
-gtitle	string	Graph title	Any string
-gsubtitle	string	Graph subtitle	Any string
-gxtitle	string	Graph x axis title	Any string	Residue Position
-gytitle	string	Graph y axis title	Any string
-goutfile	string	Output file for non interactive displays	Any string
-gdirectory	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

Input files for usage example

File: abiview.abi

This file contains non-printing characters and so cannot be displayed here.

File: abiview.abi

This file contains non-printing characters and so cannot be displayed here.

Output file format

Output files for usage example

File: abiview.fasta

>abiview
GNNNNNNNNNGNGNNGGGGTTTNANNNTNNNAGAACCCCCCTTNGAAAANNNCCACCCCA
NNATAGTNGTANGAATAGTNCCCAGGCCANGCCTATCTGTGATGATTACATAGGCTAACA
CATGACAAACATTTAAAAACACTAAACAATTGTTATTTATTCTTTGTTCCTATAAACCAC
ACCCATTAAGCCCTTACTATATATAAGAGTTTTCAAGCCAAGAACCTGCTGCTTGGGAGG
CTGATGCAGGAGAATTGCCAAGTACAAACCCTGCCTGGACTGTAAAGTGAAACCAAGGCT
AGTTGTCTCACAATAAAAGATGAAGGGCAAGTGGGATCAATGCATAAAGGAGCTTGTGCC
CAAGCCTGTTAGCCTTAGTTCAATTCCTGAGTACCATGAAAAGGTAGAAGGAGAGAAATG
ATTTGGTACAATTTTTCTCTGTGCTGTGACACAGTACCACCCTCCTACTAATAACAAATA
AAATAATGTTTAAAACAAAATAAAATAAAAATGGACTGGGATGTAGCACAATGGTAGGGT
ACTTGCATAGCATGTACAAGGACCTGATTTCAATCCCCTGTGATAAAAGAAAATAAGGAA
GGGAGGAAGCGTTAGGAGGAAAAATGGAATACAGAAGACACAGTGCATGGGAAGGATATG
TATGTTATGAACACCAGAAATTCACTTGAAAATGAGTAAAATTTTTTTATTATTATATCA
TTATTATTGGGGGGGATGTGGGCGGGGCTTGCAGAGGTATCTTTTAGAGGANGATCATTT
TCCGGTTGTTGAGCAGGGCTCTGTTATGTAGGATATCTCAGANTAACAGACCCCAGGT

Graphics File: abiview.ps

The horizontal scale of the output image labelled 'Residue Position' is only a very approximate indication of the spacing of residues in the image. The real residue spacing is variable, as it relies on the speed with which the oligo-nucleotides are eluted in the ABI sequencer. Do not be surprised to see the nucleotide signals spaced at a much greater distance than the horizontal scale might suggest.

Data files

Notes

An ABI file (*.abi) contains sequence trace data and base calls from a run of an ABI nucleotide sequencer machine. A trace data file is what you get back from having some DNA sequenced, for example, by a 3730XL sequencer. The files are in "binary" format and so cannot be viewed directly on screen. To inspect the sequencing data you must use a trace viewer such as abiview. Another good trace viewer is FinchTV (http://www.geospiza.com/finchtv/). It is a stand-alone program and is freely available.

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

Comments