shuffleseq

Wiki

Please help by correcting and extending the Wiki pages.

Function

Description

shuffleseq reads one or more sequences and writes them out again in a random (shuffled) order. The number of shuffles may be specified. Only the order of sequences is changed, no bases or residues are changed.

Usage

This makes two randomised copies of the input sequence:

% shuffleseq -shuffle 2 Shuffles a set of sequences maintaining composition Input sequence(s): tembl:L48662 output sequence(s) [l48662.fasta]:

Go to the input files for this example
Go to the output files for this example

Command line arguments

Shuffles a set of sequences maintaining composition
Version: EMBOSS:6.4.0.0

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -shuffle            integer    [1] Number of shuffles (Any integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier	Type	Description	Allowed values	Default
Standard (Mandatory) qualifiers
[-sequence] (Parameter 1)	seqall	Sequence(s) filename and optional format, or reference (input USA)	Readable sequence(s)	Required
[-outseq] (Parameter 2)	seqoutall	Sequence set(s) filename and optional format (output USA)	Writeable sequence(s)	<*>.format
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-shuffle	integer	Number of shuffles	Any integer value	1
Associated qualifiers
"-sequence" associated seqall qualifiers
-sbegin1 -sbegin_sequence	integer	Start of each sequence to be used	Any integer value	0
-send1 -send_sequence	integer	End of each sequence to be used	Any integer value	0
-sreverse1 -sreverse_sequence	boolean	Reverse (if DNA)	Boolean value Yes/No	N
-sask1 -sask_sequence	boolean	Ask for begin/end/reverse	Boolean value Yes/No	N
-snucleotide1 -snucleotide_sequence	boolean	Sequence is nucleotide	Boolean value Yes/No	N
-sprotein1 -sprotein_sequence	boolean	Sequence is protein	Boolean value Yes/No	N
-slower1 -slower_sequence	boolean	Make lower case	Boolean value Yes/No	N
-supper1 -supper_sequence	boolean	Make upper case	Boolean value Yes/No	N
-sformat1 -sformat_sequence	string	Input sequence format	Any string
-sdbname1 -sdbname_sequence	string	Database name	Any string
-sid1 -sid_sequence	string	Entryname	Any string
-ufo1 -ufo_sequence	string	UFO features	Any string
-fformat1 -fformat_sequence	string	Features format	Any string
-fopenfile1 -fopenfile_sequence	string	Features file name	Any string
"-outseq" associated seqoutall qualifiers
-osformat2 -osformat_outseq	string	Output seq format	Any string
-osextension2 -osextension_outseq	string	File name extension	Any string
-osname2 -osname_outseq	string	Base file name	Any string
-osdirectory2 -osdirectory_outseq	string	Output directory	Any string
-osdbname2 -osdbname_outseq	string	Database name to add	Any string
-ossingle2 -ossingle_outseq	boolean	Separate file for each entry	Boolean value Yes/No	N
-oufo2 -oufo_outseq	string	UFO features	Any string
-offormat2 -offormat_outseq	string	Features format	Any string
-ofname2 -ofname_outseq	string	Features file name	Any string
-ofdirectory2 -ofdirectory_outseq	string	Output directory	Any string
General qualifiers
-auto	boolean	Turn off prompts	Boolean value Yes/No	N
-stdout	boolean	Write first file to standard output	Boolean value Yes/No	N
-filter	boolean	Read first file from standard input, write first file to standard output	Boolean value Yes/No	N
-options	boolean	Prompt for standard and additional values	Boolean value Yes/No	N
-debug	boolean	Write debug output to program.dbg	Boolean value Yes/No	N
-verbose	boolean	Report some/full command line options	Boolean value Yes/No	Y
-help	boolean	Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose	Boolean value Yes/No	N
-warning	boolean	Report warnings	Boolean value Yes/No	Y
-error	boolean	Report errors	Boolean value Yes/No	Y
-fatal	boolean	Report fatal errors	Boolean value Yes/No	Y
-die	boolean	Report dying program messages	Boolean value Yes/No	Y
-version	boolean	Report version number and exit	Boolean value Yes/No	N

Input file format

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

Database entry: tembl:L48662

ID   L48662; SV 1; linear; mRNA; STD; MUS; 366 BP.
XX
AC   L48662;
XX
DT   04-NOV-1995 (Rel. 45, Created)
DT   04-MAR-2000 (Rel. 63, Last updated, Version 4)
XX
DE   Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy
DE   chain mRNA.
XX
KW   .
XX
OS   Mus musculus (house mouse)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Glires; Rodentia; Sciurognathi; Muroidea;
OC   Muridae; Murinae; Mus.
XX
RN   [1]
RP   1-366
RX   DOI; 10.1002/eji.1830260939.
RX   PUBMED; 8814271.
RA   Wloch M.K., Alexander A.L., Pippen A.M., Pisetsky D.S., Gilkeson G.S.;
RT   "Differences in V kappa gene utilization and VH CDR3 sequence among
RT   anti-DNA from C3H-lpr mice and lupus mice with nephritis";
RL   Eur. J. Immunol. 26(9):2225-2233(1996).
XX
DR   IMGT/LIGM; L48662.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..366
FT                   /organism="Mus musculus"
FT                   /strain="C3H/HeJ-lpr/lpr"
FT                   /mol_type="mRNA"
FT                   /cell_line="C3H/F2-11"
FT                   /cell_type="hybridoma"
FT                   /tissue_type="spleen"
FT                   /db_xref="taxon:10090"
XX
SQ   Sequence 366 BP; 100 A; 90 C; 85 G; 89 T; 2 other;
     gagnnccagc tgcagcagtc tggacctgag ctggtaaagc ctggggcttc agtgaagatg        60
     tcctgcaagg cttctggata cacattcact agctatgtta tgcactgggt gaatcagaag       120
     cctgggcagg gccttgagtg gattggatat attaatcctt acaatgatgg tactaactac       180
     aatgagaagt tcaaaggcaa ggccacactg acttcagaca aatcctccag cacagcctac       240
     atggagttca gcagcctgac ctctgaggac tctgcggtct attactgtgc aagaaaaact       300
     tcctactata gtaacctata ttactttgac tactggggcc aaggcaccac tctcacagtc       360
     tcctca                                                                  366
//

Output file format

The output is a standard EMBOSS sequence file.

The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Output files for usage example

File: l48662.fasta

>L48662 L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA.
aggtttttatattacaagcatactaagagactcgcgatgatcgcacaattccaaatgtgc
tcatgggtgtagcaagaacctcaaataaaagggcaaccatgagggtaaagtctccgcatg
agcccctgggacgcgagagactttctcccgctagtgggtcgaacctgcagtgtcgataat
tggagttaaaatcgcagcatttacggccatgaattgtgtcgatanacgattcacgcaatc
gttaagatcaggttcattgggntcacaaaccgtaggccccccgttgcctgacgcgtaacg
ttcggatttccgtgacttcatctgactactctgtcacattcttacacgacaagctcaaca
agccgg
>L48662 L48662.1 Mus musculus (cell line C3H/F2-11) chromosome 12 anti-DNA antibody heavy chain mRNA.
gtggatggtatccctaacccatgacttgcgattccattgactaataccgatttcgctatg
cgaataatactgcacaataagcgctgggggttggtttaaanttgcgatgtattatcaggt
gcatcatacgcgtgtcttcaatcgcaggagaatacaaactcagtcccaagcctaaggcgc
gtgagacttcattagggcaacggatactgctaactagttaaactcgcatgtaacaactca
cctgagcggtcgtacatgggcctctcttcccgaagggttgttcgaaaaaagcattgatac
aggccaggcaagcaccacgtgtcagcactacgatggccgttntcaaagtagctcatacag
cctcgc

Each run will produce a different sequence.

Note that these two sequences have the same name.

Data files

Notes

shuffleseq is useful for producing sets of sequences with randomised order which can be used for checking the statistics of sequence similarity searches.

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Author(s)

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

Comments